UEU Digital Repository feedhttps://digilib.esaunggul.ac.idUEU Digital Repository | Digital Library , Theses, Journal Article, Publication, Research, Heritage, Paper, Multimedia , Literature, DocumentidCopyright (C) 2012-2022 UEU Digital RepositoryPERBEDAAN PEMILIHAN MAKANAN DAN FAKTOR YANG BERKAITAN PADA REMAJA PUTRI DI SMA DAERAH KOTA DAN KABUPATENPenelitian ini bertujuan untuk menganalisis perbedaan pemilihan makanan dan faktor yang berkaitan pada remaja putri di SMA daerah Kota dan KabupatenPenelitian ini menggunakan cross-sectional design Teknik sampling yang digunakanadalah teknik besar sampel beda 2 proporsi dengan responden sebanyak 78 siswipada 2 lokasi penelitian Pengambilan data dilakukan dengan memberikan angketresponden yang meliputi pemilihan makan media sosial body image pengetahuangizi label pangan dan teman sebaya Pengukuran antropometri dilakukan denganmengukur berat badan dan tinggi badan Uji statistik yang digunakan adalah uji bedat-test Tidak terdapat perbedaan pemilihan makan penggunaan media sosial persepsibentuk tubuh aktual persepsi bentuk tubuh yang diinginkan dan persepsi bentuktubuh ideal di kota dan kabupaten p005 Terdapat perbedaan persepsi bentuktubuh aktual dengan IMT pengetahuan gizi pemahaman label pangan danpengaruh teman sebaya di kota dan kabupaten p005 Tidak terdapat perbedaanpemilihan makan antara remaja putri di kota dan kabupaten tetapi terdapatperbedaan pada faktor-faktor yang berkaitan dengan pemilihan makanhttps://digilib.esaunggul.ac.id/perbedaan-pemilihan-makanan-dan-faktor-yang-berkaitan-pada-remaja-putri-di-sma-daerah-kota-dan-kabupaten-23038.htmlTue, 18 Jan 2022 19:59:57 +0700HUBUNGAN ASUPAN STATUS GIZI AKTIVITAS FISIK TINGKAT STRES DAN SIKLUS MENSTRUASIATLET BULUTANGKISGangguan siklus menstruasi dapat mengakibatkan penurunan performa pada atlet Asupan yang tidak seimbang beratnya latihan status gizi tidak normal dan stress dapat meningkatkan risiko terjadinyagangguan Penelitian ini bertujuan menganalisis hubungan asupan status gizi aktivitas fisik dan tingkatstres terhadap gangguan siklus menstruasi pada atlet bulutangkis Penelitian ini menggunakan jenispenelitian kuantitatif dengan desain penelitian cross sectional dan sampel berjumlahkan 20 atlet Datadiperoleh melalui online google form yaitu data asupan karbohidrat protein lemak zat besi folat danvitamin C dengan Food Record 3x24 jam status gizi dengan IMTU aktivitas fisik dengan lembar IPAQtingkat stress dengan lembar kuesioner HARS dan siklus menstruasi Analisis data menggunakanuji Korelasi Spearman Rank Hasil Penelitian menunjukkan ada hubungan antara hubungan asupankarbohidrat p 0015 r 0535 asupan protein p 0021 r -0513 asupan lemak p 0021 r -0513 vitamin C p 0048 r 0447 dan gangguan siklus menstruasi pada atlet bulutangkis Namuntidak ditemukannya hubungan antara zat besi folat status gizi aktivitas fisik dan tingkat stress terhadapgangguan siklus menstruasi pada atlet bulutangkis p 005 Ada hubungan yang bermakna antaraasupan karbohidrat protein lemak vitamin C dan gangguan siklus menstruasi pada atlet bulutangkis putrihttps://digilib.esaunggul.ac.id/hubungan-asupan-status-gizi-aktivitas-fisik-tingkat-stres-dan-siklus-menstruasiatlet-bulutangkis-23037.htmlTue, 18 Jan 2022 19:52:12 +0700HUBUNGAN FLATFOOT DENGAN SUDUT Q ANGLE PADA PELARITujuan Untuk mengetahui hubungan Flatfoot dengan sudut Q-Angle pada pelari di arena GBK Senayan Jakarta Metode Jenis penelitian ini adalah penelitian deskriptif korelatif dengan menggunakan pendekatan cross sectional dengan identifikasi purposive sampling yang sampelnya berjumlah 17 orang Pemeriksaan Flatfoot menggunakan kuesioner Foot Postur Index FPI dan pengukuran sudut Q-Angle menggunakan Goniometer Hasil Uji korelasi dengan Pearson Product Moment didapatkan hubungan yang bermakna dengan p 0000 dimana p nilai 945 005 dengan r 0595 yang artinya terdapat hubungan yang bermakna antara Flatfoot dengan sudut Q-Angle dimana semakin tinggi nilai Flatfoot maka semakin besar sudut Q-Angle Rata-rata dan standar deviasi Flatfoot sebesar 5623593 dan Q-Angle 1809193https://digilib.esaunggul.ac.id/hubungan-flatfoot-dengan-sudut-q-angle-pada-pelari-23036.htmlTue, 18 Jan 2022 14:28:55 +0700ANALISA DAMPAK HUKUM RENCANA DIKELUARKANNYA BIDANG USAHA PENYELENGGARAAN PELAYANAN NAVIGASI PENERBANGAN DARI DAFTAR NEGATIF INVESTASI DNIPemerintah berencana melakukan relaksasi terhadap Peraturan Presiden Perpres No 44 Tahun 2016 Tentang Daftar Bidang Usaha yang Tertutup dan Bidang Usaha Yang Terbuka dengan Persyaratan Penanaman Modal yang rencananya akan mengeluarkan 14 dari 20 Daftar investasi negatif yang termuat dalam perpres No 44 Tahun 2016 salah satunya dalam bidang usaha Penyelenggaraan Pelayanan Navigasi Penerbangan Penyelenggaraan Pelayanan Navigasi Penerbangan yang sebelumnya menjadi bidang usaha yang tertutup bagi Penanaman Modal dimungkinkan menjadi bidang usaha terbuka yang dapat dimasuki Modal Dalam Negeri maupun Modal Asing Dengan dibukanya bidang usaha tertutup tersebut menjadi bidang usaha terbuka tentunya memiliki konsekuensi Hukum terhadap Prepres yang rencananya dikeluarkan tersebut dan juga dampak dampak lainnyaAdapun Masalah dalam penelitian ini adalah 1 Bagaimana aspek Hukum terkait dengan rencana relaksasi Perpres No 44 Tahun 2016 yang direncanakan mengubah bidang usaha Penyelenggaraan Pelayanan Navigasi Penerbangan dari bidang usaha tertutup menjadi Bidang Usaha terbuka 2 Apakah dampak Relaksasi Perpres 44 Tahun 2016 Terhadap Bidang Usaha Penyelenggaraan Pelayanan Navigasi Penerbangan jika benar benar dilakukan oleh Pemerintah Tipe Penelitian ini adalah yuridis normative maka dari itu pendekatan yang digunakan adalah pendekatan perundang undangan statue approach pendekatan analisis analytical approach pendekatan historis historical approach dan pendekatan komparatif comparative approach Dari analisa dapat disimpulkan bahwa Bidang usaha penyelenggaraan pelayanan navigasi Penerbangan merupakan bidang usaha yang berkaitan dengan Kedaulatan Pertahanan dan Keamanan Negara sehingga menurut Hukum Positif yang ada harus tetap menjadi bidang usaha Tertutup yang masuk dalam Daftar Negatif Investasi DNI sehingga mengeluarkan bidang usaha Penyelenggaraan Pelayanan Navigasi Penerbangan dari Daftar Negatif Investasi adalah sebuah pelanggaran terhadap regulasi perundang undangan yang adahttps://digilib.esaunggul.ac.id/analisa-dampak-hukum-rencana-dikeluarkannya-bidang-usaha-penyelenggaraan-pelayanan-navigasi-penerbangan-dari-daftar-negatif-investasi-dni-23035.htmlTue, 18 Jan 2022 14:10:30 +0700PERAN AKUNTANSI MANAJEMEN LINGKUNGAN DALAM MEMEDIASI INOVASI RAMAH LINGKUNGAN PADA NILAI PERUSAHAAN TERHADAP PERUSAHAAN DI BEIPenelitian ini tentang peran akuntansi manajemen lingkungan dalam memediasi inovasi ramah lingkungan dengan menggunakan pengungkapan CSR terhadap nilai perusahaan Penelitian ini menggunakan perusahaan manufaktur sub sektor industri dasar dan kimia yang terdaftar di BEI pada tahun 2017 2019 dikarenakan sub sektor tersebut memiliki pengaruh lebih besar terhadap pencemaran lingkungan Populasi penelitian ini adalah perusahaan manufaktur sektor industri dasar dan kimia yang terdaftar di BEI tahun 2017-2019 yang berjumlah 71 perusahaan dan sampel penelitian sebanyak 46 perusahaan dengan menggunakan metode purposive sampling Penelitian ini menggunakan pendekatan deskriptif dari metode kuantitatif Hasil penelitian menunjukkan bahwa inovasi ramah lingkungan memiliki pengaruh terhadap akuntansi manajemen lingkungan dan secara langsung berpengaruh signifikan terhadap nilai perusahaan Akuntansi manajemen lingkungan secara langsung memiliki pengaruh signifikan terhadap nilai perusahaan Akuntansi manajemen lingkungan tidak dapat memediasi antara inovasi ramah lingkungan dengan nilai perusahaan pada perusahaan sektor industri dasar dan kimia yang terdafatar di BEIhttps://digilib.esaunggul.ac.id/peran-akuntansi-manajemen-lingkungan-dalam-memediasi-inovasi-ramah-lingkungan-pada-nilai-perusahaan-terhadap-perusahaan-di-bei-23034.htmlTue, 18 Jan 2022 13:55:35 +0700PERANCANGAN APLIKASI MOBILE E-SALES UNTUKPEMBUKTIAN KUNJUNGAN DI CABANG MENGGUNAKAN METODE DESIGN THINKING DI PTGUARDIAN PHARMATAMAhttps://digilib.esaunggul.ac.id/perancangan-aplikasi-mobile-esales-untukpembuktian-kunjungan-di-cabang-menggunakan-metode-design-thinking-di-ptguardian-pharmatama-23033.htmlTue, 18 Jan 2022 13:45:24 +0700ANALISIS FAKTOR DETERMINAN KEJADIAN OBESITAS REMAJA DI DKI JAKARTAGizi lebih pada remaja memiliki dampak buruk pada kesehatansalah satu dampaknya adalah masalah Penyakit Tidak MenularPTM seperti diabetes jantung dan stroke Gizi lebih pada remajaini akan berdampak negatif terus menerus pada generasi penerusbangsa indonesia Oleh karena itu urgensi dari penelitian tentangAnalisis Faktor Determinan Kejadian Obesitas Remaja di DKIJakarta ini bisa memberikan masukan dalam pengambilankebijakan kesehatan gizi dan aktifitas fisik bagi remaja di DKIJakarta tentu harapan kami bisa secara luas se-Indonesiahttps://digilib.esaunggul.ac.id/analisis-faktor-determinan-kejadian-obesitas-remaja-di-dki-jakarta-23032.htmlTue, 18 Jan 2022 12:01:07 +0700PERIODESISASI GIZI DAN PELATIHANDalam perkembangan dunia olahraga Indonesia saat ini pihak-pihak yangterlibat didalamnya termasuk praktek gizi olahraga mengalami berbagai perubahanmulai dari presepsi sampai ke pola yang diberikan Gizi yang dulu dipraktekkan dalamkonteks komunitas saat ini sudah mengarah ke personal Perubahan ini terjadi karenapemahaman dimana setiap individu memiliki kebutuhan yang berbeda sesuai dengankarakteristik pribadi masing-masing dalam konteks olahraga hal ini berlaku untuksetiap atlet Sebagai contoh adalah bagaimana supplemen terus berkembang dari yang hanya beberapa zat gizi makro vitamin dan mineral kini berkembang lebihspesifik untuk jenis olahraga tertentu atau fungsi tertentu dan dengan komposisi yangberaneka ragam Tidak hanya isi dan kegunaan bahkan bentuk suplemen pun terusberkembang semakin baik dimana sebelumnya hanya dalam bentuk kapsul danminuman kini sudah berkembang dalam bentuk gel bar dan berbagai bentuk lainsesuai dengan kebutuhan dan kesesuaian penggunaan para atlet Lebih lanjut perihalketentuan doping juga ikut berkembang seiring perkembangan supelemen dengansemakin banyaknya bahan yang digunakan dalam suplemen ternyata masuk kedalamlist panjang dopinghttps://digilib.esaunggul.ac.id/periodesisasi-gizi-dan-pelatihan-23031.htmlTue, 18 Jan 2022 11:48:55 +0700PANDUAN PENDAMPINGAN GIZI PADA ATLETSalah satu hal penting dalam menunjang keberhasilan seorang atlet adalah pemenuhangizi yang tepat sehingga tercapai kondisi isik yang prima dan performa yang optimaldalam memperoleh prestasi terbaiknya Pemenuhan gizi yang tepat meliputipemenuhan energi dan kecukupan zat gizi spesiik seperti lemak protein vitamin danmineral berkaitan erat dengan pola konsumsi seorang atlet Dalam mencapaipemenuhan gizi yang tepat seorang atlet memerlukan pendampingan gizi dari seorangtenaga gizi Pendampingan gizi dilakukan sebagai upaya perbaikan pemeliharaanpengaturan pemulihan dan penyesuaian status gizi serta komposisi tubuh atlet yangmeliputi massa otot dan massa lemak Kami berharap pihak-pihak yang terkait dengan keolahragaan dapat bersinergi danmenggalang komitmen untuk mendukung pembinaan gizi olahraga sehingga atletdapat memperoleh pendampingan gizi secara profesional untuk menunjang performadan prestasinya Semoga Panduan ini dapat menjadi acuan bagi tenaga gizi tenagakesehatan pengurus pelatih atlet dan masyarakat pemerhati olahraga gunamemajukan prestasi atlet di Indonesiahttps://digilib.esaunggul.ac.id/panduan-pendampingan-gizi-pada-atlet-23030.htmlTue, 18 Jan 2022 11:41:17 +0700BUKU PINTAR GIZI BAGI ATLETSalah satu hal penting dalam menunjang keberhasilan seorang atletadalah pemenuhan gizi yang tepat sehingga tercapai kondisi sik yangprima dan performa yang optimal dalam memperoleh prestasi terbaiknyaPemenuhan gizi yang tepat meliputi pemenuhan energi dan kecukupanzat gizi spesik seperti lemak protein vitamin dan mineral berkaitan eratdengan pola konsumsi seorang atlet Dalam mencapai pemenuhan giziyang tepat seorang atlet memerlukan pengetahuan untuk dapat memilihmakanan sehingga memenuhi kebutuhan gizi optimalKami berharap media ini dapat bermanfaat untuk meningkatkanpengetahuan atlet serta berguna bagi pihak-pihak yang terkait dengankeolahragaan untuk dapat menggalang komitmen dalam pembinaan giziolahraga Semoga Media Edukasi ini dapat disebarluaskan kepadapengurus pelatih dan masyarakat pemerhati olahraga guna memajukanprestasi atlet di Indonesiahttps://digilib.esaunggul.ac.id/buku-pintar-gizi-bagi-atlet-23029.htmlTue, 18 Jan 2022 11:31:52 +0700HUBUNGAN ASUPAN ENERGI KARBOHIDRAT SERAT DENGAN KADAR GULA DARAH PADA PASIEN INTENSIVE CARE UNIT DI RUMAH SAKIT SILOAM KEBON JERUKPasien yang berada di ruang intensive care unit ICU sering disebut dengan pasien sakit kritis Pasien kritis sering mengalami kondisi metabolik yang dapat memetabolisme kalori total untuk memenuhi kebutuhan pengeluaran energi Pasien kritis juga sering mengalami respons sistemik akibat dari ketidakseimbangan antara pelepasan oksigen dengan persediaan oksigen pada jaringan yang telah rusak atau yang disebut hipermetabolisme Kejadian hipermetabolisme ini yang dapat mempengaruhi kondisi status gizi pasien hal inilah yang membuat pentingnya asuhan gizi pada pasien ICU Tujuan penelitian untuk mengetahui bagaimana proses asuhan gizi terstandar pada pasien intensive care unit di Rumah Sakit Siloam Kebon Jeruk Penelitian ini bersifat deskriptif dengan rancangan studi kasus Pengumpulan data dilakukan dengan menggunakan data sekunder rekam medis di ruangan intensive care unit Kriteria inklusi pasien yang berdiagnosa Chronic kidney disease on Hemodialisa CKD on HD dengan komplikasi minimal perawatan 3 hari dengan pemberian asupan enteral Pengukuran food record menggunakan data flow chart yang berisi obat-obatan cairan hasil monitoring ahli gizi rumah sakit Data biokimia diperoleh dari hasil laboratorium selama 3 hari perawatan Diagnosa gizi kedua pasien adalah penurunan kesadara kurangya intake makanan dan minuman penurunan kebutuhan zat gizi tertentu serta perubahan nilai laboratorium hemoglobin kadar gula darah puasa kreatinin ureum Selama perawatan pasien melakukan hemodialisa karena perburukan kondisi Asupan gizi selama perawatan tidak seluruhnya tercapai karena keadaan kondisi klinishttps://digilib.esaunggul.ac.id/hubungan-asupan-energi-karbohidrat-serat-dengan-kadar-gula-darah-pada-pasien-intensive-care-unit-di-rumah-sakit-siloam-kebon-jeruk-23028.htmlTue, 18 Jan 2022 11:26:46 +0700FIT SAAT BERPUASA TETAP BUGAR DI BULAN RAMADHANMenjalani puasa ramadhan merupakan saat untuk mengatur diri danmelatih diri dari berbagai godaan dunia Selama Anda menjalani puasa dalam seharian penuh asupan gizi harus terpenuhi sesuai dengan kebutuhan Untuk standar puasa di Indonesia sekitar 13 jam dan durasipuasa ini tiap negara berbeda-beda bisa lebih lama ataupun lebih cepat Biasanya dalam sehari pola makan kita 3 kali makan utama dan 2 kalimakan selingan Saat puasa pola konsumsi Anda harus bergizi seimbangya Nah lebih lanjut kita akan bahas di dalam buku inihttps://digilib.esaunggul.ac.id/fit-saat-berpuasa--tetap-bugar-di-bulan-ramadhan-23027.htmlTue, 18 Jan 2022 11:22:57 +0700FAKTOR RISIKO YANG BERHUBUNGAN DENGAN KEJADIAN PRE-EKLAMPSIA PADA IBU HAMIL DI RUMAH SAKIT SINT CAROLUS JAKARTA TAHUN 2020Pre-eklampsia didefinisikan sebagai timbulnya hipertensi disertai proteinuria pada umur kehamilan 20 minggu atau segera setelah persalinan Prevalensi pre-eklampsia di Indonesia mencapai 34-85 kejadian Terdapat banyak faktor risiko untuk terjadinya pre-eklampsia diantaranya adalah usia tingkat pendidikan paritas status gizi riwayat hiperetensi dan kepatuah ANC Berdasarkan data statistik ibu bersalin milik Rumah Sakit Sint Carolus tahun 2020 kejadian pre-eklampsia mencapai 34 kasus dari total seluruh persalianan Tujuan penelitian ini untuk mengetahui faktor risiko yang berhubungan dengan kejadian pre-eklampsia pada ibu hamil Penelitian ini merupakan penelitian kuantitatif dengan desain case control Penelitian ini dilakukan pada bulan Mei-Agustus 2021 Populasi dalam penelitian ini adalah seluruh rekam medis ibu hamil yang pernah dirawat di Rumah Sakit Sint Carolus pada Januari-Desember 2020 sebanyak 646 rekam medis Sampel kasus dalam penelitian ini adalah 22 rekam medis ibu hamil pre-eklampsia dan sampel kontrol dalam penelitian ini adalah 22 rekam medis ibu hamil tidak pre-eklampsia Metode pengambilan sampel untuk sampel kasus dan kontrol dalam penelitian ini adalah menggunakan teknik simple random sampling Analisis data dilakukan dengan uji univariat dan bivariate menggunakan chi square Hasil analisis univariat proporsi tertinggi ibu hamil dengan usia tidak berisiko 33 orang 75 tingkat pendidikan 8805SMA 40 orang 909 paritas berisiko 38 orang 864 status gizi obesitas 32 orang 727 tidak memiliki riwayat hipertensi 25 orang 568 patuh melakukan ANC 38 orang 864 Hasil analisa bivariat terdapat hubungan antara status gizi p value 0018 OR 8333 dan riwayat hipertensi p value 0000 OR 16889 dengan kejadian pre-eklampsia Tidak terdapat hubungan antara usia p value 1000 OR 0784 tingkat pendidikan p value 1000 OR 1000 paritas p value 0185 OR 6176 kepatuhan ANC p value 0664 OR 2222 dengan kejadian pre-eklampsia Disarankan kepada pihak rumah sakit agar dapat membentuk kelas khusus sebagai sarana belajar bersama dan peningkatan pengetahuan serta keterampilan ibu tentang gizi dan dalam kehamilan bagi ibu hamil yang obesitas dan meningkatkan lagi promosi senam hamil serta yoga sebagai upaya pencegahan bagi ibu hamil yang memiliki riwayat hipertensihttps://digilib.esaunggul.ac.id/faktor-risiko-yang-berhubungan-dengan-kejadian-preeklampsia-pada-ibu-hamil-di-rumah-sakit-sint-carolus-jakarta-tahun-2020-23026.htmlTue, 18 Jan 2022 11:09:26 +0700PEER REVIEW FIT SAAT BERPUASA TETAP BUGAR DI BULAN RAMADHANLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Buku Referensi Penulis Nazhif Gifari Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-fit-saat-berpuasa-tetap-bugar-di-bulan-ramadhan-23025.htmlTue, 18 Jan 2022 11:05:47 +0700PEER REVIEW PANDUAN PENDAMPINGAN GIZI PADA ATLETLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Buku Referensi Penulis Nazhif Gifari Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-panduan-pendampingan-gizi-pada-atlet-23024.htmlTue, 18 Jan 2022 11:00:49 +0700PEER REVIEW BUKU PINTAR GIZI BAGI ATLETLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Buku Referensi Penulis Nazhif Gifari Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-buku-pintar-gizi-bagi-atlet-23023.htmlTue, 18 Jan 2022 10:56:37 +0700PEER REVIEW EFFECT OF HIGH-INTENSITY INTERVAL TRAINING AND PRE-MEAL WATER CONSUMPTION ON LIPID PROFILE IN OVERWEIGHT AND OBESE STUDENTSLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Internasional Bereputasi Malaysian Journal of Nutrition Penulis Nazhif Gifari Penulis Pertamahttps://digilib.esaunggul.ac.id/peer-review-effect-of-highintensity-interval-training-and-premeal-water-consumption-on-lipid-profile-in-overweight-and-obese-students-23022.htmlTue, 18 Jan 2022 10:51:38 +0700STRATEGI KOMUNIKASI PEMASARAN KEDAI KOPI COGER BEKASI MELALUI INSTAGRAM DENGAN CAMPAIGN MINUM SEPUASNYA BAYAR SEIKHLASNYAPenelitian dilakukan untuk mengetahui bagaimana strategi komunikasi pemasaran Kedai Kopi Coger Bekasi melalui Instagram dengan campaign minum sepuasnya bayar seihlasnya Digital Marketing Communication dipakai sebagai teori dasar saat meneliti Penelitian menggunakan metode pendekatan kualitatif lalu tipe penelitian deskriptif Metode penelitian yang digunakan adalah metode kualitatif Subjek penelitian ini adalah kegiatan yang dilaksanakan bagi mereka yang terlibat diKedai Kopi Coger Bekasi Untuk teknik pengumpulan datanya yaitu melalui pengamatan langsung dan wawancara secara mendalam dan melalui studi literatur dan dokumentasi Teknik validitas data menggunsksn triangulasi sumber Hasil penelitian mengetahui strategi yang dilaksanakan oleh Kedai Kopi Coger yaitu menerapkan kegiatan komunikasi pemasaran untuk campaign yang mereka buat menggunakan digital media Instagram dengan fitur Instagram Ads Kesimpulan penelitian dinyatakan semua kegiatan dalam sstrategi komunikasi pemasaran digital media Instagram dilaksanakan secara keseluruhanhttps://digilib.esaunggul.ac.id/strategi-komunikasi-pemasaran-kedai-kopi-coger-bekasi-melalui-instagram-dengan-campaign-minum-sepuasnya-bayar-seikhlasnya-23021.htmlTue, 18 Jan 2022 10:44:53 +0700PEER REVIEW PENGARUH LATIHAN DAN KONSELING GIZI TERHADAP PERUBAHAN STATUS GIZI DEWASA OBESITASLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Ilmu Gizi Indonesia Penulis Nazhif Gifari Penulis Pertamahttps://digilib.esaunggul.ac.id/peer-review-pengaruh-latihan-dan-konseling-gizi-terhadap-perubahan-status-gizi-dewasa-obesitas-23020.htmlTue, 18 Jan 2022 10:27:32 +0700PEER REVIEW FAKTOR VO2 MAX ATLET SOFTBALL PUTRI DI PEMUSATAN LATIHAN NASIONAL PELATNAS ASIAN GAMES 2018LEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi JUARA Jurnal Olahraga Penulis Nazhif Gifari Penulis Kelimahttps://digilib.esaunggul.ac.id/peer-review-faktor-vo2-max-atlet-softball-putri-di-pemusatan-latihan-nasional-pelatnas-asian-games-2018-23019.htmlTue, 18 Jan 2022 10:22:38 +0700PEER REVIEW HUBUNGAN ASUPAN STATUS GIZI AKTIVITAS FISIK TINGKAT STRES DAN SIKLUS MENSTRUASI ATLET BULUTANGKISLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Tidak Terakreditasi Sport and Nutrition Journal Penulis Nazhif Gifari Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-hubungan-asupan-status-gizi-aktivitas-fisik-tingkat-stres-dan-siklus-menstruasi-atlet-bulutangkis-23018.htmlTue, 18 Jan 2022 10:16:19 +0700OPTIMASI IN HOUSE REAL-TIME POLYMERASE CHAIN REACTION RT-PCR UNTUK AMPLIFIKASI GEN BCL-2 PADA SAMPEL SALIVA MANUSIAGen BCL-2 merupakan anggota keluarga protein Bcl-2 yang berperan dalam mengatur proses apoptosis Namun dapat menyebabkan penyakit berbahaya seperti kanker jika diekspresikan secara berlebihan sehingga diperlukan adanya metode yang dapat mengukur tingkat ekspresi gen BCL-2 Penelitian ini dilakukan dengan tujuan untuk mendapatkan kondisi RT-PCR yang optimal untuk gen BCL-2 dari sampel saliva Sampel RNA diisolasi dari saliva yang digunakan dalam real-time Reverse Transcriptase PCR RT-PCR Metode Two Step PCR digunakan dalam penelitian ini artinya produksi cDNA dan DNA dilakukan dalam tabung terpisah Ada 3 set primer yang digunakan untuk RT-PCR ini yaitu Primer A Forward GTGGATGACTGAGTACCTGAAC Reverse GAGACAGCCAGGAGAAATCAA B Forward GGAGGATTGTGGCCTTCTTT Reverse GTTCAGGTACTCAGTCATCCAC dan C Forward GGATGCCTTTGTGGAACTGTA Reverse CCAAACTGAGCAGAGTCTTCAG yang telah dianalisis dengan software bioinformatika sebagai kandidat terbaik Optimasi konsentrasi primer dilakukan dengan menggunakan 200-400 nM dan suhu annealing pada 60-65 C Kami menggunakan Sistem Deteksi Bio-Rad CFX96 Connect Real-Time dengan suhu gradien untuk pengoptimalan Hasil penelitian menunjukkan bahwa primer C Forward GGATGCCTTTGTGGAACTGTA Reverse CCAAACTGAGCAGAGTCTTCAG merupakan primer yang paling optimal dengan suhu annealing 603C dan konsentrasi akhir 400 nM untuk RT-PCR Dari penelitian ini juga dapat dikatakan bahwa sampel saliva dapat digunakan dalam RT-PCR untuk gen BCL-2https://digilib.esaunggul.ac.id/optimasi-in-house-realtime-polymerase-chain-reaction-rtpcr-untuk-amplifikasi-gen-bcl2-pada-sampel-saliva-manusia-23017.htmlTue, 18 Jan 2022 10:14:35 +0700PEER REVIEW PERBEDAAN PEMILIHAN MAKANAN DAN FAKTOR YANG BERKAITAN PADA REMAJA PUTRI DI SMA DAERAH KOTA DAN KABUPATENLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Nazhif Gifari Penulis Ketigahttps://digilib.esaunggul.ac.id/peer-review-perbedaan-pemilihan-makanan-dan-faktor-yang-berkaitan-pada-remaja-putri-di-sma-daerah-kota-dan-kabupaten-23016.htmlTue, 18 Jan 2022 10:04:47 +0700PEER REVIEW PENGETAHUAN STATUS HIDRASI PERSEN LEMAK TUBUH KADAR HEMOGLOBIN DAN KEBUGARAN ATLET SENAMLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Nazhif Gifari Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-pengetahuan-status-hidrasi-persen-lemak-tubuh-kadar-hemoglobin-dan-kebugaran-atlet-senam-23015.htmlTue, 18 Jan 2022 02:38:40 +0700PEER REVIEW HUBUNGAN ASUPAN ENERGI ZAT GIZI MAKRO DAN MIKRO TERHADAP KEBUGARAN ATLET DYVA TAEKWONDO CENTRE CIBINONGLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Nazhif Gifari Penulis Ketigahttps://digilib.esaunggul.ac.id/peer-review-hubungan-asupan-energi-zat-gizi-makro-dan-mikro-terhadap-kebugaran-atlet-dyva-taekwondo-centre-cibinong-23014.htmlTue, 18 Jan 2022 02:30:28 +0700REPRESENTASI TINDAK TUTUR EKSPRESIF PADA PODCAST MAHASISWA UEU SEBAGAI ALTERNATIF BAHAN AJAR BAHASA INDONESIA DI SDTuturan tidak sopan sering terjadi pada siswa SD saat berbincang dengan guru orang tua dansesama temannya Hal tersebut perlu adanya media pembelajaran untuk dijadikan saranabelajar siswa SD untuk berbicara sopan yang bisa diaplikasikan dalam pembelajaran bahasaIndonesia di SD Tujuan penelitian ini untuk mengetahui representasi tindak tutur ekspresifpada podcast mahasiswa Universitas Esa Unggul dengan menggunakan pendekatan pragmatikdan dijadikan alternatif bahan ajar mata pelajaran bahasa Indonesia di SD Metode penelitianmenggunakan metode analisis isi dengan pendekatan kualitatif Hasil penelitian berkaitandengan episode ke satu sampai episode tiga puluh satu maka ditemukannya 1 tindak tuturekspresif ucapan terima kasih sebanyak 31 episode 2 tindak tutur ekspresif mengkritiksebanyak 6 episode 3 tindak tutur ekspresif mengeluh sebanyak 3 episode 4 tindak tuturekspresif menyalahkan sebanyak 3 epiosode 5 tindak tutur ekspresif memuji sebanyak 18episode 6 tindak tutur ekspresif meminta maaf sebanyak 31 episode 7 dan tindak tuturekspresif menyindir sebanyak 9 episode Tuturan ekspresif yang ditemukan dapat disimpulkanbahwa tuturan podcast mahasiswa Universitas Esa Unggul masih memenuhi tuturan normanormakesantunanberbahasasehinggabisadijadikanalternatifbahanajarbahasaIndonesiauntuksiswaSDhttps://digilib.esaunggul.ac.id/representasi-tindak-tutur-ekspresif-pada-podcast-mahasiswa-ueu-sebagai-alternatif-bahan--ajar-bahasa-indonesia-di-sd-23013.htmlTue, 18 Jan 2022 02:11:43 +0700PEER REVIEW HADIS-HADIS KOSMOLOGIS TINJAUAN SAINS DALAM KUTUB AL TIS AHLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Tidak Terakreditasi Penulis Rohmat Romdoni Penulis Utamahttps://digilib.esaunggul.ac.id/peer-review-hadishadis-kosmologis-tinjauan-sains-dalam-kutub-al-tis-ah-23012.htmlMon, 17 Jan 2022 23:09:25 +0700PEER REVIEW RELATIONSHIP BETWEEN NUTRITION KNOWLEDGE AND AEROBIC FITNESS IN YOUNG GYMNASTSLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Internasional Bereputasi Penulis Nazhif Gifari Penulis Pertamahttps://digilib.esaunggul.ac.id/peer-review-relationship-between-nutrition-knowledge-and-aerobic-fitness-in-young-gymnasts-23011.htmlMon, 17 Jan 2022 20:41:05 +0700PENGARUH KEGIATAN GERAKAN MASYARAKAT HIDUP SEHAT GERMAS DENGAN KEJADIAN HIPERTENSI DI PROVINSI DKI JAKARTA TAHUN 2018 ANALISIS DATA RISKESDAS 2018Hipertensi merupakan penyakit yang prevalensinya terus mengalami peningkatan di Provinsi DKI Jakarta Kegiatan Gerakan Masyarakat Hidup Sehat GERMAS merupakan salah satu kegiatan yang dirancang oleh Kementerian Kesehatan RI untuk mencegah dan mengendalikan terjadinya hipertensi dengan cara melakukan aktivitas fisik mengonsumsi buah dan sayur tidak merokok tidak mengonsumsi alkohol dan rutin melakukan pemeriksaan tekanan darah Penelitian ini bertujuan untuk mengetahui hubungan kegiatan Gerakan Masyarakat Hidup Sehat GERMAS dengan kejadian hipertensi di Provinsi DKI Jakarta pada tahun 2018 Teknik pengambilan sampel menggunakan simple random sampling dengan jumlah sampel 192 responden Analisis data menggunakan data Riset Kesehatan Dasar Riskesdas dengan desain penelitian cross sectional Metode analisis yang digunakan analisis regresi logistik ganda Uji statstik dalam penelitian menunjukan bahwa faktor yang paling berpengaruh dengan kejadian hipertensi adalah konsumsi buah dan sayur OR 5245 95 CI 2374-11586 dan melakukan aktivitas fisik OR 2499 95 CI 1192-5239 Diharapkan masyarakat untuk membudayakan untuk konsumsi buah dan porsi sayur sebanyak 5 porsi dan melakukan aktivitas fisik minimal 30 menit setiap harihttps://digilib.esaunggul.ac.id/pengaruh-kegiatan-gerakan-masyarakat-hidup-sehat-germas-dengan-kejadian-hipertensi-di-provinsi-dki-jakarta-tahun-2018-analisis-data-riskesdas-2018-23010.htmlMon, 17 Jan 2022 16:30:46 +0700FAKTOR FAKTOR YANG MEMPENGARUHI SUSTAINABILITY REPORTING PADA INDUSTRI PERBANKANPeni Indah Rusita Dewi Faktor Faktor Yang Mempengaruhi Sustainability Reporting Pada Industri Perbankan Dibimbing Oleh Dr Muhammad Fachruddin Arrozi SE Ak MSiPenelitian ini bertujuan untuk melihat pengaruh dewan komisaris komite audit profitabilitas dan ukuran perusahaan terhadap pembuatan sustainability report pada industri perbankan di Indonesia yang terdaftar dalam Bursa Efek Indonesia BEI Jumlah bank yang menjadi sampel dalam penelitian ini sebanyak 18 bank dengan data time seris dalam kurun waktu tiga tahun sehingga jumlah data sebanyak 54 data Penelitian ini berdasarakan puposive sampling Pengujian hipotesis menggunakan regresi logistik dengan menggunakan program statistikHasil pengujian menunjukan bahwa dewan komisaris komite audit profitabilitas dan ukuran perusahaan memiliki pengaruh secara simultan terhadap sustainability reporting Dewan komisaris secara parsial tidak berpengaruh signifikan terhadap sustainability reporting Komite audit profitabilitas ukuran perusahaan secara parsial berpengaruh signifikan terhadap sustainability reportinghttps://digilib.esaunggul.ac.id/faktor--faktor-yang-mempengaruhi-sustainability-reporting-pada-industri-perbankan-23009.htmlMon, 17 Jan 2022 16:17:56 +0700PENGARUH GOOD CORPORATE GOVERNANCE DAN STRUKTUR MODAL TERHADAP MANAJEMEN LABA PADA INDUSTRI PERBANKAN YANG TERDAFTAR DI BURSA EFEK INDONESIA BEI TAHUN 2018-2019Penelitian ini bertujuan untuk mengetahui pengaruh good corporate governance dan struktur modal terhadap manajemen laba baik secara parsial maupun secara bersama sama Dalam penelitian ini Good Corporate Governance GCG yang terdiri dari Kepemilikan Institusional Dewan Direksi Dewan Komisaris Kepemilikan Manajerial dan Komite Audit Struktur modal diproksikan dengan menggunakan Debt to Equity Ra-tio DER sedangkan manajemen laba di proksikan dengan model Beaver Engel Penelitian ini menggunakan data sekunder yaitu industri perbankan yang terdaftar di Bursa Efek Indonesia BEI periode 2018 2019 Sampel yang digunakan sebanyak 39 industri melalui metode purposive sampling Penelitian ini menggunakan metode kausali-tas sebab akibat Metode analisis data dengan menggunakan analisis regresi linier ber-ganda Lalu kemudian diolah data melalui program SPSS statistik versi 25Hasil pengujian hipotesis menunjukkan bahwa secara simultan kepemilikan institusional dewan direksi dewan komisaris kepemilikan manajerial komite audit dan struktur modal berpengaruh terhadap manajemen laba Secara parsial dewan direksi berpengaruh negatif terhadap manajemen labahttps://digilib.esaunggul.ac.id/pengaruh-good-corporate-governance-dan-struktur-modal-terhadap-manajemen-laba-pada-industri-perbankan-yang-terdaftar-di-bursa-efek-indonesia-bei-tahun-20182019-23008.htmlMon, 17 Jan 2022 14:51:56 +0700PENGARUH ASET TIDAK BERWUJUD UKURAN PERUSAHAAN KEPATUHAN PERPAJAKAN DAN LEVERAGE TERHADAP PRAKTIK TRANSFER PRICING PADA PERUSAHAAN MANUFAKTURPenelitian ini bertujuan untuk mengetahui pengaruh aset tidak berwujud ukuran perusahaan kepatuhan perpajakan dan leverage terhadap transfer pricing Analisis data menggunakan regresi linier berganda pada 12 perusahaan manufaktur yang terdaftar di Bursa Efek Indonesia BEI selama periode 2015-2019 Hasil penelitian ini menunjukkan bahwa aset tidak berwujud ukuran perusahaan kepatuhan perpajakan dan leverage secara serempak berpengaruh signifikan terhadap keputusan perusahaan dalam melakukan praktik transfer pricing serta aset tidak berwujud dan leverage secara parsial berpengaruh positif dan signifikan terhadap transfer pricing Namun ukuran perusahaan secara parsial berpengaruh negatif dan siginifikan terhadap transfer pricing Sedangkan kepatuhan perpajakan tidak berpengaruh signifikan terhadap transfer pricinghttps://digilib.esaunggul.ac.id/pengaruh-aset-tidak-berwujud-ukuran-perusahaan-kepatuhan-perpajakan-dan-leverage-terhadap-praktik-transfer-pricing-pada-perusahaan-manufaktur-23007.htmlMon, 17 Jan 2022 14:38:49 +0700PENGARUH KEBIJAKAN HUTANG UKURANPERUSAHAAN KEPEMILIKAN INSTITUSIONALKEPEMILIKAN MANAJERIAL DAN PROFITABILITASTERHADAP NILAI PERUSAHAANPenelitian ini bertujuan untuk mengetahui pengaruh kebijakan hutang ukuranperusahaan kepemilikan institusional kepemilikan manajerial dan profitabilitas terhadapnilai perusahaan Sampel penelitian terdiri atas 6 perusahaan makanan dan minumanperiode 2013-2018 yang dipilih secara purposive sampling dengan kriteria tertentuHasil penelitian ini menunjukkan bahwa kebijakan hutang ukuran perusahaankepemilikan institusional kepemilikan manajerial dan profitabilitas secara simultanberpengaruh signifikan terhadap nilai perusahaan serta ukuran perusahaan secara parsialberpengaruh positif signifikan terhadap nilai perusahaan Sedangkan kebijakan hutangkepemilikan institusional kepemilikan manajerial dan profitabilitas tidak berpengaruhsignifikan terhadap nilai perusahaanhttps://digilib.esaunggul.ac.id/pengaruh-kebijakan-hutang-ukuranperusahaan-kepemilikan-institusionalkepemilikan-manajerial-dan-profitabilitasterhadap-nilai-perusahaan-23006.htmlMon, 17 Jan 2022 14:02:15 +0700PEER REVIEW CHOCOLATE BAR WITH MORINGA AND DATES AS CALCIUM-RICH FOOD WITH LOW GLYCEMIC INDEX FOR ENDURANCE ATHLETESLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Tidak Terakreditasi Penulis Nazhif Gifari Penulis Keempathttps://digilib.esaunggul.ac.id/peer-review-chocolate-bar-with-moringa-and-dates-as-calciumrich-food-with-low-glycemic-index-for-endurance-athletes-23005.htmlMon, 17 Jan 2022 13:50:09 +0700TURNITIN RELATIONSHIP BETWEEN NUTRITION KNOWLEDGE AND AEROBIC FITNESS IN YOUNG GYMNASTSCek Similarity Index 8 Internet Sources 5 Publications 1 Students Papers 5https://digilib.esaunggul.ac.id/turnitin-relationship-between-nutrition-knowledge-and-aerobic-fitness-in-young-gymnasts-23004.htmlMon, 17 Jan 2022 12:50:14 +0700TURNITIN ANALISIS FAKTOR DETERMINAN KEJADIAN OBESITAS REMAJA DI DKI JAKARTACek Similarity Index 16 Internet Sources 16 Publications 7 Students Papers 7https://digilib.esaunggul.ac.id/turnitin-analisis-faktor-determinan-kejadian-obesitas-remaja-di-dki-jakarta-23003.htmlMon, 17 Jan 2022 12:45:18 +0700TURNITIN EFFECT OF HIGH-INTENSITY INTERVAL TRAINING AND PRE-MEAL WATER CONSUMPTION ON LIPID PROFILE IN OVERWEIGHT AND OBESE STUDENTSCek Similarity Index 7 Internet Sources 5 Publications 5 Students Papers 2https://digilib.esaunggul.ac.id/turnitin-effect-of-highintensity-interval-training-and-premeal-water-consumption-on-lipid-profile-in-overweight-and-obese-students-23002.htmlMon, 17 Jan 2022 12:35:02 +0700REKONSTRUKSI KEDUDUKAN DAN KEWENANGANDEWAN KEHORMATAN PENYELENGGARA PEMILIHAN UMUMSalah satu cara mewujudkan visi pembangunan bangsa melalui peningkatan kualitas demokrasi diperlukan institusi-institusi negara untuk mengawal prosespenyelenggaraan negara Dewan Kehormatan Penyelenggara Pemilihan Umummerupakan salah satu lembaga yang dibentuk dalam praktik demokrasi modern diIndonesia yang bertujuan untuk perbaikan kualitas demokrasi khususnya dalampenyelenggaraan Pemilihan Umum dan Pemilihan Kepala Daerah Pemilihan Umum danPemilihan Kepala Daerah menjadi salah satu target dalam perubahan bahkan begituberharganya Pemilihan Umum dan Pemilihan Kepala Daerah dibutuhkan lembaga khususyang permanen melakukan penegakan kode etik guna menghasilkan Pemilihan Umumdan Pemilihan Kepala Daerah yang tidak saja langsung umum bebas dan rahasia sertajujur dan adil tetapi juga mewujudkan proses dan hasil pemimpin yang betul-betulbermartabat Kedudukan Dewan Kehormatan Penyelenggara Pemilihan Umum perludiperkuat untuk menegakkan kode etik tidak hanya pada penyelenggara Pemilihan Umumdan Pemilihan Kepala Daerah saja tetapi juga penyelenggara negara pada umumnyahttps://digilib.esaunggul.ac.id/rekonstruksi-kedudukan-dan-kewenangandewan-kehormatan-penyelenggara-pemilihan-umum-23001.htmlMon, 17 Jan 2022 12:03:26 +0700TURNITIN EFFECT OF CONTINUOUS ENVIRONMENTAL ENRICHMENT EXPOSURE AND AEROBIC EXERCISE ON RAT S PLASMA AND HIPPOCAMPAL BRAIN8209DERIVED NEUROTROPHIC FACTOR BDNFCek Similarity Index 8 Internet Sources 0 Publications 8 Students Papers 3https://digilib.esaunggul.ac.id/turnitin-effect-of-continuous-environmental-enrichment-exposure-and-aerobic-exercise-on-rat-s-plasma-and-hippocampal-brain8209derived-neurotrophic-factor-bdnf-23000.htmlMon, 17 Jan 2022 11:51:36 +0700PERCEIVED PRICE SEBAGAI ANTESEDEN HAPPINESS DAN LOYALTY PEMBELAJARAN DARI RESTORAN CEPAT SAJI DI INDONESIAPelanggan restoran cepat saji menilai harga yang dirasakan berdasarkan kualitas produk kualitas servis dan kualitas lingkungan fisik restoran Harga yang dirasakan akan menimbulkan kepuasan pelanggan yang menumbuhkan happiness dan loyalitas yang diakhiri dengan kepercayaan pelanggan Tujuan dari penelitian adalah untuk mengeksplorasi perceived price sebagai anteseden happiness dan loyalty pada restoran cepat saji di indonesia Penelitian ini dilakukan pada 130 resoponden yang menjadi pelanggan KFCMcDPizza Hut di Indonesia Pengumpulan data diperoleh melalui kuesioner yang disebar secara online pada bulan Juni hingga Juli 2021 Kami menggunakan Lisrel Structural Equation Model SEM untuk menguji model penelitian ini Hasil pengolahan data menunjukan bahwa Perceived price berpengaruh positif pada kepuasan pelanggan Kualitas produk berpengaruh positif terhadap kepuasan pelanggan Kualitas servis berpengaruh positif terhadap kepuasan pelanggan Kualitas lingkungan fisik berpengaruh positif terhadap kepuasan pelanggan Perceived price berpengaruh positif pada kualitas produk Perceived price berpengaruh positif pada kualitas servis Perceived price berpengaruh positif terhadap kualitas lingkungan fisik Kepuasan pelanggan berpengaruh positif terhadap loyalitas pelanggan Kepercayaan memoderasi hubungan kepuasan pelanggan dan loyalitas pelanggan Kepuasan pelanggan berpengaruh positif terhadap happiness pada pelanggan KFCMcDPizza Hut di Indonesiahttps://digilib.esaunggul.ac.id/perceived-price-sebagai-anteseden-happiness-dan-loyalty-pembelajaran-dari-restoran-cepat-saji-di-indonesia-22999.htmlMon, 17 Jan 2022 11:37:12 +0700PENGARUH KUALITAS PELAYANAN PERSEPSI HARGA CITRA MEREK TERHADAP LOYALITAS PELANGGAN PADA MAHASISWA PENGGUNA GRAB FOOD DI SEKOLAH VOKASI IPB BOGORPenelitian ini bertujuan untuk menganalisis pengaruh kualitas pelanggan persepsi harga dan citra merek terhadap loyalitas pelanggan layanan Grab-food dilakukan pada mahasiswa di kampus Sekolah Vokasi IPB Bogor Metode penelitian yang digunakan dalam penelitian ini menggunakan analisis regresi linear berganda Jenis data yang digunakan dalam penelitian ini adalah data kualitatif yang dikuantitatifkan Sampel dalam penelitian ditetapkan berjumlah 125 responden dengan menggunakan teknik purposive sampling Metode pengumpulan data menggunakan kuesioner berbentuk angket maupun e-form Hasil penelitian menunjukan bahwa kualitas pelanggan berpengaruh positif terhadap loyalitas pelanggan persepsi harga berpengaruh positif terhadap loyalitas pelanggan citra merek berpengaruh positif dan signifikan terhadap loyalitas pelanggan Selain itu kualitas pelanggan persepsi harga dan citra merek secara bersama-sama juga berpengaruh positif terhadap loyalitas pelangganhttps://digilib.esaunggul.ac.id/pengaruh-kualitas-pelayanan-persepsi-harga-citra-merek-terhadap-loyalitas-pelanggan-pada-mahasiswa-pengguna-grab-food-di-sekolah-vokasi-ipb-bogor-22998.htmlMon, 17 Jan 2022 11:21:46 +0700PERANCANGAN SISTEM METODE TIKRAR SEBAGAI MEDIA UNTUK MEMBANTU MENGHAFAL AL-QURAN BERBASIS ANDROIDIndonesia merupakan Negara pengahafal Al-Quran terbanyak di dunia yakni mencapai30 ribu orang menurut Jawaposcom data pada tahun 2017 Terdapat dua metode dalammenghafal Al-Quran yang sering digunakan dan terbukti sangat selektif yaitu metodemenghafal per satu halaman menggunakan Mushaf Madinah dan metode pengulanganmetode Tikrar Juga dengan pesatnya perkembangan teknologi pada bidangsmartphone Hampir seluruh masyarakat Indonesia menggunakan smartphone mulai dariremaja hingga dewasa Cenderung segala hal dapat dilakukan dengan mudah dan cepatXtreme Programming XP merupakan sebuah proses rekayasa perangkat lunak yangmenggunakan pendekatan berorientasi objek serta metode ini juga sesuai jika dihadapkandengan requirement yang tidak jelas maupun terjadi perubahan-perubahan requirementyang sangat cepat Kesadaran masyarakat untuk mendekatkan diri kepada Tuhan saat inisemakin tinggi bermaksud membantu umat Islam khususnya yang memiliki waktu luanglebih sedikit dikehidupan sehari-hari namun memiliki tekad yang kuat untuk menghafalAl-Quran maka penulis merancang sistem aplikasi mobile metode Tikrar sebagai mediauntuk membantu mempermudah menghafal Al-Quran Pada tahap implementasimenggunakan bahasa pemrograman Darthttps://digilib.esaunggul.ac.id/perancangan-sistem-metode-tikrar-sebagai-media-untuk-membantu-menghafal-alquran-berbasis-android-22997.htmlMon, 17 Jan 2022 11:04:56 +0700PENGARUH IKLAN DAN DESAIN KEMASAN TERHADAP KEPUTUSAN PEMBELIAN AIR MINUM DALAM KEMASAN AMDK MEREK ADES DENGAN CITRA MEREK SEBAGAI VARIABEL INTERVENINGPenelitian ini memiliki beberapa masalah pada kurangnya iklan yang dilakukan desain kemasan yang dihadirkan Ades kurang menarik serta citra merek Ades belum begitu dikenal oleh konsumen Penelitian ini bertujuan untuk menganalisis pengaruh langsung iklan dan desain kemasan terhadap citra merek pengaruh iklan desain kemasan dan citra merek terhadap keputusan pembelian serta pengaruh tidak langsung iklan dan desain kemasan terhadap keputusan pembelian melalui citra merek Metode penelitian yang digunakan dalam penelitian ini menggunakan analisis jalur path analysis Jenis data yang digunakan dalam penelitian ini adalah data kualitatif yang dikuantitatifkan Sampel dalam penelitian ditetapkan berjumlah 165 responden dengan menggunakan teknik purposive sampling Metode pengumpulan data menggunakan kuesioner berbentuk angket maupun e-form Hasil penelitian ini menunjukan bahwa iklan dan desain kemasan berpengaruh terhadap citra merek iklan dan citra merek berpengaruh terhadap keputusan pembelian desain kemasan tidak berpengaruh terhadap keputusan pembelianhttps://digilib.esaunggul.ac.id/pengaruh-iklan-dan-desain-kemasan-terhadap-keputusan-pembelian-air-minum-dalam-kemasan-amdk-merek-ades-dengan-citra-merek-sebagai-variabel-intervening-22996.htmlMon, 17 Jan 2022 10:50:58 +0700TURNITIN CONTINUOUS ENVIRONMENTAL ENRICHMENT AND AEROBIC EXERCISE IMPROVES SPATIAL MEMORY FOCUS ON RAT HIPPOCAMPAL BDNF AND NGFCek Similarity Index 94 Internet Sources 94 Publications 94 Students Papers 68https://digilib.esaunggul.ac.id/turnitin-continuous-environmental-enrichment-and-aerobic-exercise-improves-spatial-memory-focus-on-rat-hippocampal-bdnf-and-ngf-22995.htmlMon, 17 Jan 2022 10:49:45 +0700PEER REVIEW PENGGUNAAN METODE PEMBELAJARAN KOOPERATIF TIPE STAD UNTUK MENINGKATKAN AKTIVITAS DAN HASIL BELAJAR SISWALEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Tidak Terakreditasi Penulis Mujazi Penulis Utamahttps://digilib.esaunggul.ac.id/peer-review-penggunaan-metode-pembelajaran-kooperatif-tipe-stad-untuk-meningkatkan-aktivitas-dan-hasil-belajar-siswa-22994.htmlMon, 17 Jan 2022 10:38:20 +0700PENGARUH PELATIHAN DAN KOMPETENSI KARYAWANTERHADAP EFEKTIVITAS KERJADI PT PRIMA INTERNATIONAL CARGOPenelitian ini bertujuan untuk mengetahui Pengaruh Pelatihan danKompetensi Karyawan Terhadap Efektivitas Kerja dalam penelitian ini yangmenjadi responden seluruh karyawan PT Prima International Cargo Sampel yangdigunakan sebanyak 112 responden dengan teknik pengambilan sampel yaitusampling jenuh Metode analisis data kuantitatif dengan alat Analisis RegresiLinier berganda yaitu suatu analisis yang digunakan untuk menguji pengaruhPelatihan dan Kompetensi Karyawan terhadap Efektivitas Kerja di PT PrimaInternational Cargo Hasil penelitian ini menunjukan bahwa Pelatihan danKompetensi Karyawan berpengaruh secara positif terhadap Efektivitas KerjaKompetensi terbukti memiliki pengaruh paling dominan terhadap Efektivitas Kerjahttps://digilib.esaunggul.ac.id/pengaruh-pelatihan-dan-kompetensi-karyawanterhadap-efektivitas-kerjadi-pt-prima-international-cargo-22993.htmlMon, 17 Jan 2022 10:35:36 +0700IMPLEMENTASI STRATEGI PUBLIC RELATIONS DALAM UPAYA PENCEGAHAN PEMBERANTASANPENYALAHGUNAAN DAN PEREDARAN GELAP NARKOBA P4GN PADA GENERASI MILLENNIALS STUDI KASUS PADA BADAN NARKOTIKA NASIONALPada praktiknya Government Public Relations memiliki tugas memberikan informasi mendidikmeyakinkan meraih simpati dan membangkitkan ketertarikan masyarakat akan sesuatu danmembuat masyarakat mengerti dan menerima sebuah situasi Badan Narkotika Nasionalmelalui Biro Humas dan Protokol Sekretariat Utama melakukan berbagai aktivitas atau praktikGovernment Public Relations untuk mencapai visi dan misi BNN yakni memberantas narkoba diIndonesia dengan upaya Pencegahan Pemberantasan Penyalahgunaan dan Peredaran GelapNarkoba P4GN kepada generasi millennials Dalam penelitian ini peneliti memilih metodepenelitian kualitatif deskriptif dengan dengan metode studi kasus yang bertujuan untukmengetahui strategi Public Relations BNN dalam upaya Pencegahan PemberantasanPenyalahgunaan dan Peredaran Gelap Narkoba P4GN dengan sasaran yakni generasimillennials Teori yang digunakan penulis adalah teori Strategi Public Relations PENCILS dimanasecara detail dan mendalam menganalisis strategi Public Relations yang dilakukan oleh BadanNarkotika Nasional Ditemukan bahwa Humas BNN melakukan strategi publikasi eventketerlibatan dengan komunitas informasi lobi dan negosiasi serta tanggung jawab sosialhttps://digilib.esaunggul.ac.id/implementasi-strategi-public-relations-dalam-upaya-pencegahan-pemberantasanpenyalahgunaan-dan-peredaran-gelap-narkoba-p4gn-pada-generasi-millennials-studi-kasus-pada-badan-narkotika-nasional-22992.htmlSat, 15 Jan 2022 01:32:50 +0700DIGITAL CULTURE TOWARDS INFORMATION SOCIETY CASE STUDY OF COLLABORATION BETWEEN CIG and ICT VOLUNTEERShttps://digilib.esaunggul.ac.id/digital-culture-towards-information-society-case-study-of-collaboration-between-cig-and-ict-volunteers-22991.htmlFri, 14 Jan 2022 20:55:07 +0700IDENTIFIKASI PARTISIPASI POLITIK DAN PERILAKU PEMILIH PEMULA PADA PEMILU SEBAGAI UPAYA MENINGKATKAN DAYA SAING BANGSAPenelitian ini bertujuan untuk mengidentifikasi bentuk dan jenis partisipasi politik serta pengaruh faktorsosiologis psikologis dan pilihan rasional terhadap perilaku pemilih pemula di wilayah Jakarta Barat dalammenentukan pilihan politiknya Penelitian ini menggunakan metode kuantitatif dengan pendekatan survei danmengambil sampel sebanyak 500 pemilih pemula yang berada di wilayah penelitian yang ditentukan denganmenggunakan teknik cluster sampling Teknik analisis data yang digunakan dalam penelitian ini adalah analisislinear berganda dengan mencari pengaruh faktor sosiologis X1 faktor sosiologis X2 dan faktor pilihanrasional X3 terhadap perilaku memilih Y Hasil penelitian menunjukkan bahwa faktor sosiologis X1 faktorpsikologis X2 dan pilihan rasional X3 berpengaruh secara simultan terhadap perilaku memilih Y pemilihpemula Secara parsial faktor yang berpengaruh terhadap perilaku memilih pemilih pemula adalah pilihanrasional sedangkan faktor sosiologis dan psikologis tidak berpengaruh siginifikan terhadap perilaku memilihpemilih pemulahttps://digilib.esaunggul.ac.id/identifikasi-partisipasi-politik-dan-perilaku-pemilih-pemula-pada-pemilu-sebagai-upaya-meningkatkan-daya-saing-bangsa-22990.htmlFri, 14 Jan 2022 20:40:17 +0700TURNITIN DIGITAL CULTURE TOWARDS INFORMATION SOCIETY CASE STUDY OF COLLABORATION BETWEEN CIG and ICT VOLUNTEERSCek Similarity Index 6 Internet Sources 6 Publications 3 Students Papers 2https://digilib.esaunggul.ac.id/turnitin-digital-culture-towards-information-society-case-study-of-collaboration-between-cig-and-ict-volunteers-22989.htmlFri, 14 Jan 2022 19:42:40 +0700PEER REVIEW STRATEGI PUBLIC RELATIONS DALAM MEMBANGUN PERSONAL BRANDING SENIMAN VISUAL STUDI DESKRIPTIF KUALITATIF STRATEGI PUBLIC RELATIONS DALAM MEMBANGUN PERSONAL BRANDING MUKLAY SEBAGAI SENIMAN VISUALLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Erna Febriani Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-strategi-public-relations-dalam-membangun-personal-branding-seniman-visual-studi-deskriptif-kualitatif-strategi-public-relations-dalam-membangun-personal-branding-muklay-sebagai-seniman-visual-22988.htmlFri, 14 Jan 2022 19:36:49 +0700PEER REVIEW IMPLEMENTASI STRATEGI PUBLIC RELATIONS DALAM UPAYA PENCEGAHAN PEMBERANTASAN PENYALAHGUNAAN DAN PEREDARAN GELAP NARKOBA P4GN PADA GENERASI MILLENNIALS STUDI KASUS PADA BADAN NARKOTIKA NASIONALLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Erna Febriani Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-implementasi-strategi-public-relations-dalam-upaya-pencegahan-pemberantasan-penyalahgunaan-dan-peredaran-gelap-narkoba-p4gn-pada-generasi-millennials-studi-kasus-pada-badan-narkotika-nasional-22987.htmlFri, 14 Jan 2022 19:18:22 +0700PEER REVIEW FENOMENA KEMUNCULAN KELOMPOK HOMOSEKSUAL DALAM RUANG PUBLIK VIRTUALLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Erna Febriani Penulis Tunggalhttps://digilib.esaunggul.ac.id/peer-review-fenomena-kemunculan-kelompok-homoseksual-dalam-ruang-publik-virtual-22986.htmlFri, 14 Jan 2022 19:10:56 +0700PEER REVIEW IDENTIFIKASI PARTISIPASI POLITIK DAN PERILAKU PEMILIH PEMULA PADA PEMILU SEBAGAI UPAYA MENINGKATKAN DAYA SAING BANGSALEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Prosiding Nasional Penulis Erna Febriani Penulis Pertamahttps://digilib.esaunggul.ac.id/peer-review-identifikasi-partisipasi-politik-dan-perilaku-pemilih-pemula-pada-pemilu-sebagai-upaya-meningkatkan-daya-saing-bangsa-22985.htmlFri, 14 Jan 2022 15:47:15 +0700PEER REVIEW DIGITAL CULTURE TOWARDS INFORMATION SOCIETY CASE STUDY OF COLLABORATION BETWEEN CIG and ICT VOLUNTEERSLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Prosiding Internasional Penulis Erna Febriani Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-digital-culture-towards-information-society-case-study-of-collaboration-between-cig-and-ict-volunteers-22984.htmlFri, 14 Jan 2022 15:40:05 +0700APLIKASI SISTEM INFORMASI PELAYANAN PUSKESMAS BERBASIS ANDROIDAbstrak Pelayanan Kesehatan saat ini menjadi objek yang penting bagi masyarakat Dalam penelitian ini bertujuan untuk menurunkan tingkat penyebaran virus yang dialami menggunakan aplikasi informasi pelayanan kesehatan secara online Metode analisis data dilakukan dengan metode System Developtment Life Cycle SDLC yang terdiri dari tahap perencanaan analisis desain dan implementasi Hasil penelitian menunjukan bahwa adanya aplikasi ini dapat mengurangi dampak penyebaran penyakit dikarena kan dapat melalukan konsultasi atau pun membeli obat tanpa harus mengantri dan mempermudah untuk pemesanan ruangan tanpa harus menunggu maka tidak ada lagi penumpukan pasien maupun pengunjung Kesimpulan dari hasil penelitian ini adalah aplikasi informasi pelayanan kesehatan secara online bukan hanya membantu meringankan penyebaran virus tetapi juga mempermudah dan mampu menyimpan data-data pasien tanpa adanya kesalahan dari pihak pelayanan kesehatan ataupun human error beserta semua yang telah disampaikan aplikasi initelah terselesaikanhttps://digilib.esaunggul.ac.id/aplikasi-sistem-informasi-pelayanan-puskesmas-berbasis-android-22983.htmlThu, 13 Jan 2022 14:44:30 +0700PERANCANGAN APLIKASI PEMESANAN RUANGAN BERBASIS ANDROID STUDI KASUS PTPLN PERSERO PUSENLIS JAKARTA BARATBadan Usaha Milik Negara Perseroan Terbatas Pursahaan Milik Negara Pusenlis Persero merupakan salah satu instansi pemerintahan dalam bidang listrik masyarakat perkembangan yang sudah terjadi berdampak pada semakin banyaknya suatu aktifitas yang telah terjadi di gedung PLN Pusenlis baik itu aktifitas pegawai maupun non pegawai Prosedur peminjaman ruangan yang masuh secara manual maka dari itu menyebabkan beberapa permasalahan diantaranya adalah kesulitan yang dialami oleh peminjam ruangan pada saat akan melakukan suatu peminjaman ruangan dan kesulitan yang dihadapi oleh petugas ruangan didalam mengelola atau memantau penggunaan ruangan Dari apa yang dipermasalahan tersebut muncul maka terbuatlah suatu gagasan untuk membuat suatu aplikasi Pemesanan ruangan yang berbasis platform android yang isinya terdapat bagaimana pegawai memesan ruangan melalui online Metodologi yang akan digunakan dalam membantu pembuatan suatu aplikasi ini yaitu metode extreme programming bahasa programan yang akan dipakai salah satunya yaitu javascript php Mysql sebagai database Metode analisis yang akan dipakai adalah metode Pieces untuk mengetahui apa saja masalah yang akan dihadapi dan memberikan usulan yang akan dibuat kepada suatu pihak perusahaan untuk menyelesaikan masalah Aplikasi yang dibuat nantinya akan menjadi aplikasi Pemesanan ruangan yang akan digunakan oleh pegawai tersebut di gedung PLN Pusenlis Jakarta barathttps://digilib.esaunggul.ac.id/perancangan-aplikasi-pemesanan-ruangan-berbasis-android-studi-kasus-ptpln-persero-pusenlis-jakarta-barat-22982.htmlThu, 13 Jan 2022 14:29:32 +0700APLIKASI PEMESANAN MOBIL TRUK BERBASIS MOBILEAbstrak CVGarasi Mobil Truk adalah sebuah tempat penyewaan swasta yang bergerak dalam bidangtransportasi yakni penyewaan mobil dan jasa antar barang Saat ini proses penyewaan mobil dilakukan dengancara konvensional yaitu mengontak pemilik kendaraan atau datang ke lokasi Garasi Mobil Truk Karna masihmenggunakan sistem manual kinerja yang didapatkan kurang cepat karena keseluruhan proses masihbergantung pada faktor manusia yang berarti persentase human error cukup besar dan cenderung merugikanpemilik Bisnis Mobil Truk Oleh sebab itu dikembangkan aplikasi pemesanan mobil truk ini dimana dapatmempermudah dan mempercepat dalam pemrosesan data operasional Pemesanan Mobil Truk Sementarametode yang digunakan dalam pengembangan sistem Yaitu menggunakan metode System Development LifeCycle SDLC yang terdiri dari tahap perencanaan analisis desain dan implementasi Hasil Penelitian ini yaituterwujudnya Aplikasi yang telah terintegrasi dan terkomputerisasi yang memudahkan untuk mengolah data-dataserta laporan yang diperlukan sehingga Garasi Mobil Truk dapat lebih terstruktur dengan baik dan cepat dalampelaksanaan operasionalhttps://digilib.esaunggul.ac.id/aplikasi-pemesanan-mobil-truk-berbasis-mobile-22981.htmlThu, 13 Jan 2022 13:11:31 +0700PERBEDAAN WALKING EXERCISE RETRO DAN FORWARD DENGAN LOWER LIMB ELASTIC RESISTENCE BAND EXERCISES TERHADAP KESEIMBANGAN WANITA USIA60-65 TAHUNTerdiri dari VI Bab 114 Halaman 6 Gambar 10 Tabel 4 Skema 3 Grafik 10LampiranTujuan Mengetahui perbedaan walking exercise dengan resistence bandexercises terhadap keseimbangan wanita usia 60-65 tahun Metode Penelitianberjenis experimental pretest-postest control group design keseimbangan diukurmenggunakan brief balance evaluation system test Sampel terdiri dari 20 wanitausia 60-65 tahun dan dibagi kedalam 2 kelompok perlakuan Hasil uji normalitasdengan Shapiro wilk test didapatkan data berdistribusi normal dan ujihomogenitas dengan levenes test didapatkan data homogenitas Hasil uji hipotesiskelompok perlakuan I dengan Paired Sample t-Test didapatkan P0001 denganmean sebelum 13901370 dan sesudah 17602366 menunjukan intervensiwalking exercise memiliki efek terhadap peningkatan keseimbangan pada wanitausia 60-65 tahun Kelompok perlakuan II dengan Paired Sampel t-Test nilaip0001 dengan mean sebelum 14201549 dan sesudah 18902424menunjukan intervensi resistence band exercises memiliki efek terhadappeningkatan keseimbangan pada wanita usia 60-65 tahun Hasil IndependentSample t-Test nilai p 0180 berarti tidak ada perbedaan efek peningkatankeseimbangan lansia antara kelompok perlakuan I dan kelompok perlakuan IIKesimpulan Tidak ada perbedaan efek antara walking exercise retro danforward dengan lower limb elastic resistence band exercises dalammeningkatkan keseimbangan wanita 60-65 tahunhttps://digilib.esaunggul.ac.id/perbedaan-walking-exercise-retro-dan-forward-dengan-lower-limb-elastic-resistence-band-exercises-terhadap-keseimbangan-wanita-usia6065-tahun-22980.htmlThu, 13 Jan 2022 11:57:32 +0700EFEK ISOMETRIC HIP ABDUCTION EXERCISE PADA SQUAT EXERCISE DAN LUNGES EXERCISE TERHADAP PENINGKATAN KEMAMPUAN FUNGSIONAL LUTUT PADA WANITA DENGAN KONDISI PATELLOFEMORAL PAIN SYNDROMETujuan Untuk mengetahui perbedaan efek antara isometric hip abduction exercise pada squat exercise dan lunges exercise dalam meningkatkan kemampuan fungsional lutut pada wanita dengan kondisi patellofemoral pain syndrome Metode Penelitian bersifat quasi experiment dengan pre test-post test nilai kemampuan fungsional lutut diukur menggunakan Knee Injury and Osteoarthritis Outcome Score KOOS Sampel keseluruhan 16 orang dibagi menjadi 2 kelompok Kelompok perlakuan I dengan intervensi isometric hip abduction exercise dan squat exercise memiliki nilai meanSD sebelum intervensi 59230 dan setelah intervensi 86919 kelompok perlakuan II dengan intervensi isometric hip abduction exercise exercise dan lunges exercise memiliki nilai meanSD sebelum intervensi 63554 dan setelah intervensi 69538 Hasil Uji normalitas dengan kolmogrov smirnov didapatkan data berdistribusi normal sedangkan uji homogenitas dengan levenes test didapatkan data memiliki varian homogen Hasil uji hipotesis pada kelompok perlakuan I dengan paired sample t-test didapatkan nilai p0001 yang berarti intervensi isometric hip abduction exercise dan squat exercise berpengaruh signifikan terhadap peningkatan kemampuan fungsional lutut pada wanita dengan kondisi patellofemoral pain syndrome Pada kelompok perlakuan II dengan paired sample t-test didapatkan nilai p0016 yang berarti intervensi isometric hip abduction exercise dan lunges exercise tidak berpengaruh signifikan terhadap peningkatan kemampuan fungsional lutut pada wanita dengan kondisi patellofemoral pain syndrome Pada hasil independent sample t-test menunjukkan nilai p0001 yang bermakna bahwa ada perbedaan yang signifikan terhadap kemampuan fungsional lutut pada kelompok perlakuan I dan kelompok perlakuan II Kesimpulan Ada perbedaan efek isometric hip abduction exercise pada squat exercise dan lunges exercise terhadap peningkatan kemampuan fungsional lutut pada wanita dengan kondisi patellofemoral pain syndromehttps://digilib.esaunggul.ac.id/efek-isometric-hip-abduction-exercise-pada-squat-exercise-dan-lunges-exercise-terhadap-peningkatan-kemampuan-fungsional-lutut-pada-wanita-dengan-kondisi-patellofemoral-pain-syndrome-22979.htmlThu, 13 Jan 2022 11:39:24 +0700EFEK ISOMETRIC HIP ABDUCTION EXERCISE PADA SQUAT EXERCISE DAN LUNGES EXERCISE TERHADAP STABILITAS KNEE PADA WANITA DENGAN KASUS PATELLOFEMORAL PAIN SYNDROMETujuan untuk mengetahui perbedaan isometric hip abduction exercise pada squat exercise dan lunges exercise terhadap peningkatan stabilitas knee wanita dengan kondisi patellofemoral pain syndrome Metode penelitian ini bersifat kuasi eksperimental untuk mengetahui efek suatu intervensi yang dilakukan terhadap obyek penelitian Pengukuran yang digunakan untuk melihat hasilnya adalah Star Excursion Balance Test SEBT Sampel terdiri dari 16 orang dipilih berdasarkan teknik purposive random sampling dengan menggunakan tabel assesment yang tersedia Sampel dikelompokkan menjadi 2 kelompok yaitu kelompok perlakuan I terdiri dari 8 orang dengan intervensi isometric hip abduction exercise dan squat exercise dan kelompok perlakuan II terdiri dari 8 orang dengan intervensi isometric hip abduction exercise dan lunges exercise Hasil pada uji normalitas menggunakan kolmogrov smirnov didapatkan data berdistribusi normal sedangkan uji homogenitas dengan levenes test didapatkan data memiliki varian homogen Hasil uji hipotesis pada kelompok perlakuan I dengan paired sample t-test didapatkan nilai p0001 yang berarti intervensi isometric hip abduction exercise dan squat exercise berpengaruh signifikan terhadap peningkatan stabilitas knee pada wanita dengan kondisi patellofemoral pain syndrome Pada kelompok perlakuan II dengan paired sample t-test didapatkan nilai p0213 yang berarti intervensi isometric hip abduction exercise dan lunges exercise tidak berpengaruh signifikan terhadap peningkatan stabilitas knee pada wanita dengan kondisi patellofemoral pain syndrome Pada hasil independent sample t-test menunjukan nilai p0001 yang berarti ada perbedaan yang signifikan dalam penurunan stabilitas knee pada kelompok I dan kelompok perlakuan II Kesimpulan terdapat perbedaan isometric hip abduction exercise pada squat exercise dan lunges exercise terhadap stabilitas knee pada wanita dengan kondisi patellofemoral pain syndromehttps://digilib.esaunggul.ac.id/efek-isometric-hip-abduction-exercise-pada-squat-exercise-dan-lunges-exercise-terhadap-stabilitas-knee-pada-wanita-dengan-kasus-patellofemoral-pain-syndrome-22978.htmlThu, 13 Jan 2022 11:20:33 +0700PERBEDAAN WALKING EXERCISE RETRO DAN FORWARD DENGAN LOWER LIMB ELASTIC RESISTENCE BAND EXERCISE TERHADAP KEMAMPUAN FUNGSIONAL WANITA USIA 60-65 TAHUNTujuan Untuk mengetahui perbedaan walking exercise retro dan forward denganlower limb elastic resistence band exercises terhadap kemampuan fungsional wanita usia60-65 tahun Metode Penelitian ini merupakan jenis penelitian experimental denganmenggunakan pretest-postest control group design dimana kemampuan fungsionaldiukur menggunakan 30 second chair stand test Sampel terdiri dari 20 wanita usia 60-65tahun dan di pilih dengan purposive random sampling Hasil uji normalitas denganShapiro wilk test didapatkan data berdistribusi normal dan homogen dengan levenes testHasil uji hipotesis pada kelompok perlakuan I dengan Paired Sample t-Test didapatkannilai P0000 dengan mean sebelum 10901449 dan sesudah 13001563 hal tersebutmenunjukan bahwa pemberian intervensi walking exercise retro dan forward memilikiefek terhadap peningkatan kemampuan fungsional pada wanita usia 60-65 tahunKelompok perlakuan II dengan Paired Sampel t-Test didapatkan nilai p0000 denganmean sebelum 10001333 dan sesudah 14301947 hal tersebut menunjukan bahwapemberian intervensi lower limb elastic resistence band exercises memiliki efek terhadappeningkatan kemampuan fungsional pada wanita usia 60-65 tahun Hasil IndependentSample t-Test menunjukan nilai p 0000 dengan mean selisih 1 yaitu 210 0994 danselisih 2 yaitu 4301160 berarti ada perbedaan efek peningkatan kemampuan fungsionallansia antara kelompok perlakuan I dan kelompok perlakuan II Kesimpulan Adaperbedaan efek antara walking exercise retro dan forward dengan lower limb elasticresistence band exercises dalam meningkatkan kemampuan fungsional wanita usia 60-65tahunhttps://digilib.esaunggul.ac.id/perbedaan-walking-exercise-retro-dan-forward-dengan-lower-limb-elastic-resistence-band-exercise-terhadap-kemampuan-fungsional-wanita-usia-6065-tahun-22977.htmlThu, 13 Jan 2022 11:07:52 +0700PEER REVIEW PERANCANGAN INTERAKSI PANDUAN PEMBELAJARAN BERBASIS PERSONALISASI PADA E-LEARNING MENGGUNAKAN METODE ACTIVITY-CENTERED DESIGNLEMBAR HASIL PENILAIAN SEJAWAT SEBIDANG ATAU PEER REVIEW KARYA ILMIAH Jurnal Ilmiah Nasional Terakreditasi Penulis Indriani Noor Hapsari Penulis Keduahttps://digilib.esaunggul.ac.id/peer-review-perancangan-interaksi-panduan-pembelajaran-berbasis-personalisasi-pada-elearning-menggunakan-metode-activitycentered-design-22976.htmlThu, 13 Jan 2022 07:47:02 +0700PERANCANGAN INTERAKSI PANDUAN PEMBELAJARAN BERBASIS PERSONALISASI PADA E-LEARNING MENGGUNAKAN METODE ACTIVITY-CENTERED DESIGNDi era digital sekarang ini e-Learning sudah banyak digunakan pada bidang pendidikanNamun pembelajaran melalui e-Learning memiliki sejumlah permasalahan diantaranya pembelajarandiberikan dengan menganggap semua mahasiswa memiliki kebutuhan yang sama tidak terjadinya interaksi serta keterlambatan penyelesaian aktivitas pembelajaran oleh mahasiswa Penelitian inibertujuan untuk merancang interaksi pembelajaran e-Learning dengan panduan pembelajaran yangdipersonalisasi untuk mengatasi perbedaan kemampuan dan kebutuhan mahasiswa yang berbedaMetode yang digunakan dalam perancangan interaksi ini adalah Activity-Centered Design yangmemiliki fokus pada aktivitas pembelajaran mahasiswa Perancangan interaksi diawali dengan analisisaktivitas untuk mengidentifikasi kebutuhan pengguna Selanjutnya dirancang storyboard sebagaigambaran alur aktivitas mahasiswa dengan menggunakan Task Analysis Pada tahap implementasidikembangkan prototipe interaktif dengan menggunakan software Figma Prototipe sistempembelajaran dievaluasi dengan mengujicobakan sistem kepada 12 mahasiswa untuk mengetahuitingkat usability sistem yang telah dibuat dilanjutkan dengan pengisian kuesioner untuk mengukurSystem Usability Scale SUShttps://digilib.esaunggul.ac.id/perancangan-interaksi-panduan-pembelajaran-berbasis-personalisasi-pada-elearning-menggunakan-metode-activitycentered-design-22975.htmlThu, 13 Jan 2022 07:39:20 +0700USULAN PERBAIKAN SISTEM DISTRIBUSI PRODUK PINTU DENGAN MENGGUNAKAN METODE FORECASTING DAN DISTRIBUTION REQUIREMENT PLANNING DRP STUDI KASUS DI PT XYZPT XYZ merupakan perusahaan yang bergerak dalam bidang furniture yang mendistribusikan produknya ke beberapa distributor center yang telah bekerjasama dengan perusahaan Salah satu produk yang dihasilkan yaitu pintu kayu standar Berdasarkan penelitian yang dilakukan sistem distribusi yang diterapkan oleh PT XYZ belum ada penjadwalan pendistribusian produk yang terkondisikan dengan baik dikarenakan ketidakaturan waktu dan keterlambatan pada waktu pengiriman produk Penelitian ini dilakukan untuk mengetahui perbandingan total biaya pendistribusian yang ada dengan metode Distribution Requirement Planning dan penentuan jumlah pemesanan menggunakan teknik lot sizing yang diterapkan untuk jumlah pemesanan ekonomis EOQ Safety Stock dengan tujuan untuk meminimumkan biaya pengiriman dan penyimpanan Hasil dari DRP terkecil kemudian dilakukan usulan perbaikan dengan meramalkan permintaan untuk periode yang akan datang sebagai acuan perusahaan dapat memproduksi jumlah produk pintu kayu sesuai dengan peramalan yang benar berdasarkan perhitungan Dari hasil penelitian didapat total biaya distribusi perusahaan sebesar Rp 107089780-Beradasarkan metode DRP total biaya distribusi yang diperoleh sebesar Rp 60847460- Dengan menggunakan DRP maka didapatkan penurunan dan penghematan biaya distribusi sebesar 43 atau sebesar Rp 46242320-https://digilib.esaunggul.ac.id/usulan-perbaikan-sistem-distribusi-produk-pintu-dengan-menggunakan-metode-forecasting-dan-distribution-requirement-planning-drp-studi-kasus-di-pt-xyz-22974.htmlWed, 12 Jan 2022 16:45:43 +0700PENGARUH FINANCIAL DISTRESS AUDITOR SWITCHING DAN UKURAN PERUSAHAAN TERHADAP AUDIT DELAY PADA PERUSAHAAN SEKTOR PERTAMBANGAN YANG TERDAFTAR DIBURSA EFEK INDONESIA PERIODE 2014-2018Penelitian ini bertujuan untuk mengetahui Pengaruh Financial Distress AuditorSwitching dan Ukuran Perusahaan terhadap Audit Delay Pada Perusahaan SektorPertambangan Dalam penelitian ini variabel yang digunakan Financial DistressAuditor Switching dan Ukuran Perusahaan yang diprosikan Financial Distressdengan Debt to Total Asset Auditor Switching yang diproksikan dengan VariabelDummy dan Ukuran Perusahaan diproksikan dengan Kapitalisasi Pasar Populasidalam penelitian ini adalah Perusahaan Sektor Pertambangan periode 2014 2018 Sampel dalam peneltian ini adalah 38 perusahaan sektor pertambangandengan waktu penelitian selama 5 tahun sehingga menghasilkan 190 sampel yangdiperoleh dengan teknik purposive sampling Hasil penelitian ini menunjukkanbahwa variabel Financial Distress Audtior Switching dan Ukuran Perusahaanberpengaruh secara simultan terhadap Audit Delay Secara parsial variabelFinancial Distress berpengaruh positif signifikan terhadap Audit Delay secaraparsial Auditor Switching dan Ukuran Perusahaan tidak berpengaruh terhadapAudit Delayhttps://digilib.esaunggul.ac.id/pengaruh-financial-distress-auditor-switching-dan-ukuran-perusahaan-terhadap-audit-delay-pada-perusahaan-sektor-pertambangan-yang-terdaftar-dibursa-efek-indonesia-periode-20142018-22973.htmlWed, 12 Jan 2022 16:29:18 +0700PENGARUH HARGA KUALITAS PELAYANAN DAN STORE ATMOSPHERE TERHADAP KEPUTUSAN PEMBELIAN KOPI TUKU KEMANGGISANPenelitian ini bertujuan untuk mengetahui Pengaruh Harga KualitasPelayanan dan Store Atmosphere Terhadap Keputusan Pembelian Kopi TukuPopulasi dalam penelitian ini adalah konsumen yang sudah pernah membeli dansudah pernah mengunjungi Kopi Tuku Kemanggisan Sampel dalam penelitian inidiambil dengan menggunakan Metode Non Probability Sampling denganmenggunakan teknik pengambilan sampel Purposive Sampling sebanyak 150responden Sedangkan pengumpulan data denan menyebar kuisoner Analisis datamenggunakan uji instrument yang terdiri dari uji validitas dan uji reliabilitas Ujihiporesis yang terdiri dari uji regresi linier berganda uji f uji t dan uji koefisiendeterminan R2Hasil penelitian dalam penelitian ini menunjukan bahwa variable Hargaberpengaruh positif namun tidak signifikan terhadap Keputusan Pembeliansedangkan variable Kualitas Pelayanan berpengaruh negative dan tidak signifikanterhadap Keputusan Pembelian dan Store Atmosphere berpengaruh positif dansignifikan terhadap Keputusan Pembelian Variabel Harga Kualitas Pelayanan danStore Atmosphere berpengaruh secara bersama sama terhadap KeputusanPembelian Kopi Tuku Kemanggisanhttps://digilib.esaunggul.ac.id/pengaruh-harga-kualitas-pelayanan-dan-store-atmosphere-terhadap-keputusan-pembelian-kopi-tuku-kemanggisan-22972.htmlWed, 12 Jan 2022 16:28:42 +0700PENGARUH PROMOSI DAN HARGA SERTA KUALITAS PRODUK TERHADAP KEPUTUSAN PEMBELIAN STUDI PADA MEREK ZARA LIPPO KARAWACIPenelitian ini bertujuan untuk mengetahui pengaruh promosi dan harga serta kualitas produk terhadap keputusan pembelian Objek penelitian ini merupakan pelanggan Zara Lippo Karawaci Pengambilan sampel menggunakan non probability sampling dengan teknik purposive sampling dan jumlah sampel dalam penelitian ini adalah 100 responden Teknik pengumpulan data menggunakan kuesioner wawancara dan observasi dan dokumentasi Pengujian hipotesis dalam penelitian ini menggunakan analisis jalur dan di uji dengan menggunakan SPSS versi 23Hasil uji penelitian ini menunjukan bahwa secara parsial promosi berpengaruh negatif terhadap keputusan pembelian sedangkan harga dan kualitas produk berpengaruh signifikan terhadap keputusan pembelian Sedangkan secara simultan prmosi harga dan kualitas produk berpengaruh sugnifikan terhadap keputusan pembelian Di sarankan Zara Lippo Karawaci meningkatkan promosi dan diskon harga serta kepada para pelanggan nyahttps://digilib.esaunggul.ac.id/pengaruh-promosi-dan-harga-serta-kualitas-produk--terhadap-keputusan-pembelian--studi-pada-merek-zara-lippo-karawaci-22971.htmlWed, 12 Jan 2022 16:24:06 +0700PENGARUH PRICE EARNING RATIO PER CURRENT RATIO CR Dan RETURN ON ASSET ROA TERHADAP HARGA SAHAM PADA PERUSAHAAN MANUFAKTUR SUB SEKTOR FOOD BEVERAGE YANG TERDAFTAR DI BURSA EFEK INDONESIA PERIODE 2014 2018Penelitian ini bertujuan untuk mengetahui bagaimana pengaruh dari price earning ratio curremt ratio dan return on asset terhadap harga saham pada perusahaan manufaktur sub sektor food beverage yang terdaftar di Bursa Efek Indonesia tahun 2014-2018 Sampel penelitian adalah perusahaan sektor makanan dan minuman yang terdaftar di Bursa Efek Indonesia tahun 2014-2018 Penelitian ini menggunakan data sekunder yang bersumber dari laporan keuangan tahunan perusahaan di Bursa Efek Indonesia tahun 2014-2018 Sampel diambil dengan menggunakan teknik purposive sampling yang berjumlah 50 sampel Hasil penelitian menunjukkan secara simultan price earning ratio current ratio dan return on asset berpengaruh signifikan terhadap harga saham Dan secara parsial variabel price earning ratio dan current ratio dan return on asset berpengaruh signifikan terhadap harga sahamhttps://digilib.esaunggul.ac.id/pengaruh-price-earning-ratio-per-current-ratio-cr-dan-return-on-asset-roa-terhadap-harga-saham-pada-perusahaan-manufaktur-sub-sektor-food--beverage-yang-terdaftar-di-bursa-efek-indonesia-periode-2014--2018-22970.htmlWed, 12 Jan 2022 16:15:32 +0700GAMBARAN POSTUR KERJA PADA ANGGOTA KASSA STERIL DI INSTALASI CSSD RUMKITAL Dr MINTOHARDJO JAKARTA PUSAT TAHUN 2021Postur kerja adalah orientasi rata rata dari anggota tubuh postur kerja ditentukan oleh ukurantubuh dan ukuran peralatan atau benda lainnya yang digunakan pada saat bekerja Penelitian inibertujuan untuk mengetahui gambaran postur kerja pada anggota di Instalasi CSSD RUMKITALDr Mintohardjo Jakarta Pusat tahun 2021 Jenis penelitian ini adalah kuantitatif dengan desainstudi cross sectional menggunakan metode REBA Populasi dari penelitian ini adalah seluruhanggota yang ada di Instalasi CSSD RUMKITAL Dr Mintohardjo Jakarta Pusat sebanyak 10anggota dan sampel penelitian ini adalah sebanyak 10 anggota dengan teknik total sampling Hasildari penelitian ini didapatkan bahwa proporsi tertinggi terdapat pada anggota yang memiliki posturkerja dengan tingkat risiko tinggi yaitu 9 anggota 90 sehingga diperlukan tindakan perbaikansecepatnya dan untuk proporsi terendah yang memiliki postur kerja dengan tingkat risiko sedangyaitu 1 anggota 10https://digilib.esaunggul.ac.id/gambaran-postur-kerja-pada-anggota-kassa-steril-di-instalasi-cssd-rumkital-dr-mintohardjo-jakarta-pusat-tahun-2021-22969.htmlWed, 12 Jan 2022 15:56:24 +0700FAKTOR-FAKTOR YANG BERHUBUNGAN DENGAN PERILAKU MEROKOK PADA SOPIR BUS AKAP DI TERMINAL KOTA BEKASI TAHUN 2021Perilaku merokok adalah suatu kegiatan atau aktivitas membakar rokok dankemudian menghisapnya dan menghembuskannya keluar dan dapat menimbulkanasap Berdasarkan hasil studi awal yang dilakukan pada 15 orang sopir bus AKAPdi Terminal Bus Kota Bekasi menggunakan kuesioner yang berisikan pertanyaantentang data diri responden seperti usia jenis kelamin pendidikan terakhir danpendapatan Hasil studi awal tersebut yaitu 10 orang sopir merokok dan 5 orangtidak merokok Kemudian hasil dari kuesioner tentang pengetahuan sopir yaituburuk Sikap yang dimiliki oleh supir yaitu buruk Kemudian perilaku teman yaitu9 orang teman sopir merokok 9 orang sopir bus tidak mengetahui adanya kebijakanKawasan Tanpa Rokok Kemudian berdasarkan hasil observasi di Terminal KotaBekasi banyak ditemukan iklan rokok tidak adanya kawasan bebas rokok Selainitu banyaknya penjual rokok di Terminal Kota Bekasi Penelitian ini bertujuanuntuk menganalisis faktor-faktor yang berhubungan dengan perilaku merokok padasopir bus AKAP di Terminal Kota Bekasi Tahun 2021 Penelitian ini menggunakandesain cross sectional Metode pengambilan sampel menggunakan teknikpurposive sampling dengan jumlah sampel sebanyak 115 responden Data dianalisisdengan analisis univariate dan bivariate dengan uji chi square Hasil univariatemenunjukkan proporsi tertinggi perilaku merokok sebesar 765 pengetahuantinggi sebesar 539 sikap baik sebesar 609 terpengaruh teman sebesar 60dan terpengaruh iklan sebesar 539 Hasil bivariate menunjukkan tidak adahubungan antara pengetahuan PR 1197 95 CI 0975 1470 sikap PR 1206 95 CI 0990 1471 pengaruh teman PR 1201 95 CI 0981 1469 dan pengaruh iklan PR 1091 95 CI 0887 1341 Denganbanyaknya perilaku merokok pada sopir bus AKAP maka diharapkan ada kebijakandari Terminal Kota Bekasi untuk mengadakan Kawasan Tanpa Rokokhttps://digilib.esaunggul.ac.id/faktorfaktor-yang-berhubungan-dengan-perilaku-merokok-pada-sopir-bus-akap-di-terminal-kota-bekasi-tahun-2021-22968.htmlWed, 12 Jan 2022 15:47:33 +0700DESAIN IMPELEMENTASI SISTEM HIDROPONIKDENGAN ARDUINO UNO R3 INTERNET OF THINGS IoTHidroponik adalah pola garapan yang memberdayakan air sebagai dasarperkembangan tumbuh tumbuhan Tanaman hidroponik biasanya ditempatkan didalam greenhouse yang menggunakan prinsip ventilasi alami yang dapat menjagasuhu udara dan air tetap stabil menaikkan nilai kelembaban pengukuranketinggian air agar ketinggian air tetap terjaga menyesuaikan pH air danmengukur kualitas air Pada pola cocok tanam hidroponik ini dilakukanpengaturan suhu udara suhu air kelembaban udara ketinggian air pH air danmengukur kualitas air secara otomatis dengan menggunakan sensor-sensor yangsesuai parameter dengan menggunakan mikrokontroler Arduino Uno R3 Adanyasistem otomatis ini dapat juga mencegah jamur Phytiumsp pada tanamanhidroponik Sistem ini juga dapat di monitoring melalui perangkat mobile androiddengan metode Internet of Things IoThttps://digilib.esaunggul.ac.id/desain--impelementasi-sistem-hidroponikdengan-arduino-uno-r3--internet-of-things-iot-22967.htmlWed, 12 Jan 2022 15:37:19 +0700ANALISIS WAKTU TUNGGU PELAYANAN RESEP NON RACIKAN PASIEN PROGRAM RUJUK BALIK PRB BPJS KESEHATAN DI APOTEK KIMIA FARMA KARANG TENGAH TAHUN 2021Pelayanan resep non racikan pasien Program Rujuk Balik PRB BPJS Kesehatan diApotek Kimia Farma Karang Tengah masih mengalami kendala waktu tunggu yanglama terutama di jam sibuk Berdasarkan data observasi rata-rata waktu tunggupelayanan mencapai 36 menit dimana standar waktu tunggu untuk resep non racikanadalah 8804 30 menit Penelitian ini bertujuan untuk menganalisis lama waktu tunggu danfaktor yang berhubungan dengan waktu tunggu pelayanan resep non racikan pasienPRB BPJS Kesehatan di Apotek Kimia Farma Karang Tengah tahun 2021 Penelitianini merupakan jenis penelitian kuantitatif yang dilanjutkan dengan kualitatif mixmethods dengan desain Explanatory Sequential Hasil penelitian dari lama waktutunggu pelayanan resep non racikan 30 menit lama yaitu sebanyak 59 resep 72sedangkan proporsi terendah lama waktu tunggu pelayanan resep non racikan pasienPRB BPJS Kesehatan yang 8804 30 menit normal yaitu sebanyak 23 resep 28 Rataratayang didapatkan dari hasil penelitian ini yaitu 36 menit dan lama waktu tunggumaksimal adalah 50 menit sedangkan lama waktu tunggu minimalnya adalah 10 menitBerdasarkan hasil penelitian kualitatif penyebab lamanya waktu tunggu diantaranyaadalah kurangnya sumber daya manusia terutama disaat jam sibuk dan ada pegawaiyang libur atau mendapatkan pelatihan sehingga tidak masuk seringnya jaringan yanglambat dan sistem BPJS ke Kimia Farma Apotek yang masih belum terbridging dengansempurna juga menjadi penyebab dari lamanya waktu tunggu karena petugas menjaditerhambat saat harus melakukan registrasi pasien ke sistem selain itu ketidaktahuanmengenai alur syarat dan pengambilan obat di Apotek dari pihak RS hingga Faskes 1menyebabkan adanya ketidaksamaan informasi hal ini membuat petugas apotek harusmengedukasi ulang kepada pasien sehingga waktu tunggu pun menjadi lebih lamaDiharapkan adanya keselarasan antara jumlah SDM dengan beban kerja adanyaperbaikan sistem dan jaringan kooridinasi antar pihak terkait sehingga mendukungpercepatan pengambilan obat pasien PRB BPJS Kesehatanhttps://digilib.esaunggul.ac.id/analisis-waktu-tunggu-pelayanan-resep-non-racikan-pasien-program-rujuk-balik-prb-bpjs-kesehatan-di-apotek-kimia-farma-karang-tengah-tahun-2021-22966.htmlWed, 12 Jan 2022 15:26:48 +0700FAKTOR-FAKTOR YANG BERHUBUNGAN DENGAN MOTIVASI KERJA TENAGA KESEHATAN DI UNIT RAWAT JALAN PUSKESMAS CIJAKU KABUPATEN LEBAK TAHUN 2021Motivasi kerja merupakan faktor yang paling penting dalam meningkatkan kinerja tenaga kesehatanBerdasarkan studi pendahuluan kepada lima tenaga kesehatan di unit rawat jalan Puskesmas Cijakudidapatkan hasil 80 atau 4 dari 5 orang tenaga kesehatan memiliki motivasi kerja rendah hinggasedang Penurunan motivasi yang dialami oleh para tenaga kesehatan di unit rawat jalan PuskesmasCijaku akan berdampak kepada kedisiplinan tenaga kesehatan Penelitian ini bertujuan untukmengetahui hubungan antara umur tingkat pendidikan persepsi kebijakan persepsi supervisi persepsikompensasi dan status kepegawaiandengan motivasi kerja Jenis penelitian kuantitatif analitik dengandesain penelitian cross sectional Populasi dalam penelitian ini adalah tenaga kesehatan di unit rawatjalan Puskesmas Cijaku sebanyak 39 orang Teknik pengambilan sampel menggunakan total samplingyaitu berjumlah 34 orang dikurangi 5 orang tenaga kesehatan yang mengikuti studi pendahuluan Datayang didapatkan adalah data primer dengan menggunakan kuesioner Teknik analisis yang digunakanadalah analisis univariat dan analisis bivariat Analisis univariat dilakukan untuk menggambarkanproporsi variabel yang diteliti Analisis bivariat dengan uji Chi-Square dilakukan untuk mengetahuiadanya hubungan antar variabel Hasil penelitian menunjukkan bahwa 735 tenaga kesehatan di unitrawat jalan Puskesmas Cijaku memiliki motivasi kerja yang rendah Proporsi terbesar usia tenagakesehatan adalah 32 tahun 559 berpendidikan D3 588 memiliki status kepegawaian sebagaipegawai tidak tetap 559 puas terhadap kebijakan yang berlaku 529 puas terhadap supervisi yangsudah berjalan 676 dan tidak puas dengan kompensasi 706 Berdasarkan analisis bivariatdidapatkan hasil bahwa faktor yang berhubungan dengan motivasi kerja adalah kebijakan dengan pvalue0002 PR 15167 95 CI 2837-81095 dan status kepegawaian dengan p value0038 PR5958 95 CI 1332-26662 Diharapkan pihak Puskesmas dapat mengikutsertakan para pegawaidalam pembuatan kebijakan dan memberikan tugas dengan tantangan kerja yang menarik kepadapegawaihttps://digilib.esaunggul.ac.id/faktorfaktor-yang-berhubungan-dengan-motivasi-kerja-tenaga-kesehatan-di-unit-rawat-jalan-puskesmas-cijaku-kabupaten-lebak-tahun-2021-22965.htmlWed, 12 Jan 2022 11:26:37 +0700HUBUNGAN PENGETAHUAN IBU TENTANG IMUNISASI DASAR LENGKAP DENGAN KEPATUHAN IMUNISASI DASAR PADA BALITA DI KELURAHAN JATI CEMPAKA WILAYAH KERJA UPTD PUSKESMASPONDOK GEDE KOTA BEKASITAHUN 2014Latar Belakang Salah satu target Indonesia sehat 2015 adalah mengurangi 23tingkat kematian anak-anak usia di bawah 5 tahun dengan program memberikanimunisasi dasar lengkap secara rutin Kendala utama yaitu rendahnya tingkatkesadaran akibat kurangnya pengetahuan tentang imunisasiTujuan Mengetahui hubungan pengetahuan ibu tentang imunisasi dasar lengkapdengan kepatuhan imunisasi dasar pada balita di Kelurahan Jati Cempaka WilayahKerja UPTD Puskesmas Pondok Gede Kota Bekasi tahun 2014Metode Penelitian Jenis penelitian adalah kuantitatif metode descriptif analiticdengan pendekatan cross sectional Populasi dalam penelitian ini adalah seluruhibu yang mempunyai anak usia 9 60 bulan yang datang untuk imunisasi periodeJanuari Desember 2013 sebanyak 1254 responden dan sampel sebanyak 91responden yang dipilih secara simple random sampling dengan cara lotre Analisisdata menggunakan analisis univariat dan analisis bivariat menggunakan uji ChiSquareHasil Dari 91 responden didapatkan responden yang patuh sebanyak 85responden 9341 Dengan 20 pertanyaan mengenai imunisasi dasar lengkapsecara umum didapatkan sebagian ibu memiliki pengetahuan yang cukup yaitusebesar 89 responden 9780 Sedangkan ibu yang memiliki pengetahuan yangcukup dan patuh untuk imunisasi dasar anaknya sebesar 84 responden 9438Hasil uji analisis Chi Square hitung sebesar 6256 Chi Square tabel dengan 945 5 dan df 1 yaitu 384 berarti Ho ditolak p-value 0012 005 disimpulkanada hubungan antara pengetahuan ibu tentang imunisasi dasar lengkap dengankepatuhan imunisasi pada balitaKesimpulan Pengetahuan ibu dapat mempengaruhi kepatuhan dalam imunisasidasar lengkap pada balita sehingga perlu dilakukan penyuluhan tentang hal-halyang berkaitan dengan imunisasi dasar lengkaphttps://digilib.esaunggul.ac.id/hubungan-pengetahuan-ibu-tentang-imunisasi-dasar-lengkap-dengan-kepatuhan-imunisasi-dasar-pada-balita-di-kelurahan-jati-cempaka-wilayah-kerja-uptd-puskesmaspondok-gede-kota-bekasitahun-2014-22964.htmlWed, 12 Jan 2022 11:09:48 +0700SECURITY UTILIZATION OF CLOUD COMPUTING IN THE WORLD OF BUSINESS FOR SMALL MEDIUM ENTERPRISES SMEShttps://digilib.esaunggul.ac.id/security-utilization-of-cloud-computing-in-the-world-of-business-for-small-medium-enterprises-smes-22963.htmlTue, 11 Jan 2022 23:44:33 +0700LAPORAN KERJA PRAKTIK PERANCANGAN WEB SISTEM WORKFLOW SURVEYOR PADA PT INTEGRITI ADIJAYA MENGGUNAKAN METODE PROTOTYPEPerkembangan teknologi yang pesat khususnya teknologi komputer mendorong perusahaan untuk memanfaatkan teknologi yang ada untuk memudahkan perusahaan dalam menjadalankan kegiatan perusahaan Sekarang ini dunia bergerak dengan cepat dan teknologi begitu dibutuhkan demi menyelesaikan tugas-tugas ataupun membuat suasana kerja menjadi lebih nyaman dan membuat pekerjaan terselesaikan lebih efektif dan efisienhttps://digilib.esaunggul.ac.id/laporan-kerja-praktik-perancangan-web-sistem-workflow-surveyor-pada-pt-integriti-adijaya-menggunakan-metode-prototype-22962.htmlTue, 11 Jan 2022 16:24:05 +0700PENGELOMPOKAN KEPRIBADIAN MANUSIA DITINJAU DARI ADVERSITY QUOTIENT AQ STUDI KASUS MAHASISWA FASILKOM KELAS PARALEL SEMESTER GANJIL TAHUN AKADEMIK 20172018 SESI 10 MATA KULIAH BUSINESS ENGLISH DALAM MENGATASI MASALAH BAHASA INGGRISSejauh ini kita sebagai pendidik selalu menggunakan IQ EQ dan juga SQ untuk mengetahui sejauhmana pelajar dapat mencapai prestasi mereka Kita lupa bahwa mereka akan menuju duniakerjaDunia kerja adalah berbeda dari pada dunia perkuliahan Kemudian Paul G Stoltz PhD telahdatang untuk memperkenalkan Adversity Quotient AQ to menunjukan bahwa AQ itu penting untukdiperkenal kepada dunia khususnya lembaga pendidikan AQ adalah satu perangkat untuk mengetahuisejauh mana orang dapat mengatasi masalah ketika mereka menghadapinya Melalui penelitian inipeneliti menggunakan mahasiswa dari Fakultas Ilmu Komputer tahun akademik 20172018 semesterganjil kelas parallel sebagai obyek penelitian Peneliti memberikan mata kuliah bahasa Inggris kepadapara mahasiswa itu selama satu semester dengan menggunakan standard penelitian dari PAMUPengampu Mata Kuliah Umum dengan perincian kehadiran sebanyak 10 tugas 20 UjianTengah Semester 30 dan Ujian Akhir Semester 40 Dengan menggunakan standar penilaian inipeneliti mengubahnya ke dalam konversi penilaian berdasarkan kategori yang ditentukan oleh AQyang terdiri dari tiga yaitu dari penilaian terendah yang disebut Quitters di mana orang yang beradapada kategorinya cenderung untuk berhenti berusaha bila menghadapi satu permasalahan Kategorikedua disebut Campers Orang yang termasuk dalam kategori ini bila dia menghadapi permasalahancenderung untuk bertahan dan mencari jalan aman tidak berhenti tapi tidak juga berusaha untukmenjadi lebih baik Sedangkan kategori dengan penilai tertinggi yang disebut Climbers adalahseseorang yang mampu bertahan bila menghadapi masalah dan berusaha untuk menjadi lebih baiksetelah permasalahan itu selesai dia tanganihttps://digilib.esaunggul.ac.id/pengelompokan-kepribadian-manusia-ditinjau-dari-adversity-quotient-aq-studi-kasus-mahasiswa-fasilkom-kelas-paralel-semester-ganjil-tahun-akademik-20172018-sesi-10-mata-kuliah-business-english-dalam-mengatasi-masalah-bahasa-inggris-22961.htmlMon, 10 Jan 2022 16:43:12 +0700IMPLEMENTASI PROGRAM KAMPUS MENGAJAR DI SEKOLAH DASAR SWASTA NURANI JAKARTAKampus Mengajar merupakan bagian dari program MerdekaBelajar Kampus Merdeka MBKM yang bertujuan untuk membantu sekolah-sekolah dasar yang terdampak pandemi COVID-19 Salah satu sekolah yangmenjadi sasaran program ini adalah Sekolah Dasar Swasta Nurani Jakarta Tujuanpenelitian ini adalah untuk mengetahui dan menganalisis bagaimana implementasiProgram Kampus Mengajar di sekolah sasaran dengan mengacu pada teoriimplementasi David C Korten dan keterkaitannya dengan kegiatan literasinumerasi adaptasi teknologi dan administrasi di sekolah sasaran Metode yangdigunakan dalam penelitian ini adalah deskriptif kualitatif dengan pengumpulan databerupa wawancara observasi dan dokumentasi Hasil penelitian menjelaskan bahwaimplementasi Program Kampus Mengajar di SDS Nurani berjalan dengan baik Halini ditinjau berdasarkan aspek kesesuaian program dengan sasaran program denganpelaksana dan pelaksana dengan sasaran yang sudah tepat Kegiatan literasi yangdilakukan mahasiswa adalah membantu siswa dalam membaca dan menulis Dalambidang numerasi mahasiswa mengajari siswa beragam bentuk perhitunganmatematika beserta penyelesainnya Adaptasi teknologi yang dilakukan mahasiswadi SDS Nurani adalah membantu guru membuat media pembelajaran yang menarikdan membantu penggunaan berbagai aplikasi daring untuk pembelajaran Dalam haladministrasi mahasiswa membantu guru-guru untuk mengoreksi tugas dan ujiansiswa mengawasi ujian siswa kelas 6 serta membantu mengisi e-raporthttps://digilib.esaunggul.ac.id/implementasi-program-kampus-mengajar-di-sekolah-dasar-swasta-nurani-jakarta-22960.htmlMon, 10 Jan 2022 16:27:50 +0700PENGARUH GOOD CORPORATE GOVERNANCE DANSTRUKTUR KEPEMILIKAN TERHADAP ASIMETRIINFORMASI PADA PERUSAHAAN PENGHASIL BAHANBAKU SUB SEKTOR PERKEBUNAN YANG TERDAFTARDI BURSA EFEK INDONESIA TAHUN 2014-2018Penelitian ini dilakukan dengan tujuan untuk menganalisis Pengaruh GoodCorporate Governance dan StrukturKepemilikansecara parsial dan simultanterhadap Asimetri Informasipada Perusahaan Penghasil Bahan Baku Sub SektorPerkebunan yang terdaftar di Bursa Efek Indonesia pada tahun 2014-2018Asimetri Informasi diukur menggunakan relative bid-ask spread Variabelindependen yang diteliti antara lain Good Corporate Governanceyang diproksikandengan Indeks Pengungkapan Corporate Governance IPCG dan StrukturKepemilikandiukur dengan persentase jumlah saham yang dimiliki institusi lainpenelitian ini tergolong penelitian kausalitasPopulasi dalam penelitian ini adalah seluruh perusahaan Industri PenghasilBahan Baku Sub Sektor Perkebunan yang terdaftar di Bursa Efek Indonesia padatahun 2014-2018 yang berjumlah 70 perusahaan Sedangkan sampel penelitian iniditentukan dengan metode purposive sampling sehingga diperoleh 55 perusahaansampel Jenis data yang digunakan adalah data sekunder yang diperoleh dariwwwidxcoid dan website perusahaanHasil dari penelitian ini adalah Pengaruh Good CorporateGovernancedanStrukturKepemilikansecara simultan berpengaruh terhadapAsimetri Informasiyang diproksikan dengan dengan Indeks PengungkapanCorporate Governance IPCG ETR dikurangi CETR dengan signifikansi 0000 005 Secara parsial variabel Good Corporate Governance tidak berpengaruhterhadap asimetri informasi sedangkan Struktur Kepemilikan berpengaruhterhadap asimetri informasihttps://digilib.esaunggul.ac.id/pengaruh-good-corporate-governance-danstruktur-kepemilikan-terhadap-asimetriinformasi-pada-perusahaan-penghasil-bahanbaku-sub-sektor-perkebunan-yang-terdaftardi-bursa-efek-indonesia-tahun-20142018-22959.htmlMon, 10 Jan 2022 15:15:15 +0700PENGARUH PEMBERIAN TANDEM WALKING EXERCISEDENGAN CORE STABILITY EXERCISE TERHADAPPENINGKATKAN DYNAMIC BALANCE PADA PASIENPASCA STROKE HEMIPARESISTujuan Untuk mengetahui subjektivitas perbedaan core stability exercise dantandem walking exercise pada peningakatan dynamic balance pada pasien pascastroke Metode Penelitian bersifat quasi experimental dengan pre test-post testdesain Total sampel dalam penelitian ini adalah 12 orang yang dibagi menjadi 2kelompok dan tiap kelompok berjumlah 6 orang Kelompok I dengan intervensicore stability exercise dan kelompok II tandem walking exercise dengan nilaipeningakatan dynamic balance diukur dengan Time Up and Go Hasil Ujihipotesis I dan II dengan paired sampel t-test menunjukkan nilai p0001 danp0015 Hal ini berarti pemberian intervensi kelompok I ataupun II secarasignifikan dapat meningkatkan dynamic balance pada pasien pasca strokeSelanjutnya hipotesis III antara dua kelompok dengan independent sampel t-testdiperoleh nilai p0097 artinya tidak terdapat perbedaan yang signifikan antarakelompok perlakuan I dan kelompok perlakuan II Kesimpulan Ada pengaruhcore stability exercise pada peningkatan dynamic balance pada pasien pascastroke ada pengaruh tandem walking exercise pada peningakatan dynamicbalance pada pasien pasca stroke dan tidak ada perbedaan yang signifikan antaracore stability exercise dan tandem walking exercise terhadap peningkatandynamic balance pada pasien pasca strokehttps://digilib.esaunggul.ac.id/pengaruh-pemberian-tandem-walking-exercisedengan-core-stability-exercise-terhadappeningkatkan-dynamic-balance-pada-pasienpasca-stroke-hemiparesis-22958.htmlMon, 10 Jan 2022 15:03:53 +0700EFEKTIVITAS METODOLOGI PELATIHAN TERHADAP PERILAKU KERJA INOVATIF DAN KINERJA KARYAWAN PEMERINTAHAN DI MEDIASI OLEH SOFT SKILL DAN KECERDASAN EMOSIONAL DI MASA PANDEMI COVID 19Penelitian ini akan meneliti tentang hubungan antara metodologi pelatihan terhadap perilaku kerja inovatif dan kinerja karyawan pemerintahan dimediasi kecerdasan emosional dan soft skill dimasa pandemi covid 19 Dimana tujuan penelitian untuk mengetahui dari pengaruh metodologi pelatihan terhadap soft skill kecerdasan emosional perilaku kerja inovatif dan kinerja karyawan pengaruh soft skill terhadap kinerja karyawan pengaruh kecerdasan emosional terhadap kinerja karyawan dan perilaku kerja inovatif Objek pada penelitian ini adalah karyawan Aparatur Sipil Negara yang bekerja pada bidang pendidikan khususnya di Jakarta Penelitian ini menggunakan pendekatan kuantitatif dimana menggunakan alat ukur kuesioner dan analisis faktor konfirmatori untuk menguji validitas konvergen dari ukuran konstruk menggunakan metode analisis Partial Least Square PLS untuk memperkirakan kesesuaian model yang dihipotesiskan Total sampel sebanyak 160 responden dengan jumlah pertanyaan 70 butir pertanyaan menggunakan teknik sampel jenuh uji validitas dan reabilitas dan mengembangkan digram model SEM yang bertujuan untuk melihat hubungan kausal yang diuji Penelitian ini menemukan bahwa metodologi pelatihan berpengaruh signifikan terhadap soft kill metodologi pelatihan berpengaruh signifikan terhadap kecerdasan emosional metodologi pelatihan berpengaruh siginifikan terhadap perilaku kerja inovatif metodologi pelatihan berpengaruh signifikan terhadap kinerja karyawan serta peran mediasi dari kecerdasan emosional dan soft skill berpengaruh positif dan signifikan metodologi pelatihan terhadap perilaku kerja inovatif dan kinerja karyawan Hasil penelitian ini diharapkan dapat menjadi referensi untuk diterapkan pada instansi pemerintahan di Indonesia untuk menitik beratkan pada peran metodologi pelatihan terhadap soft skill kecerdasan emosional perilaku kerja inovatif dan kinerja karyawan selain itu instansi juga dapat meningkatkan perilaku kerja inovatif dan kinerja karyawan dengan keterlibatan metodologi pelatihan terhadap kecerdasan emosional dan soft skill yang berdampak positif bagi instansinyahttps://digilib.esaunggul.ac.id/efektivitas-metodologi-pelatihan-terhadap-perilaku-kerja-inovatif-dan-kinerja-karyawan-pemerintahan-di-mediasi-oleh-soft-skill-dan-kecerdasan-emosional-di-masa-pandemi-covid-19-22957.htmlMon, 10 Jan 2022 14:51:01 +0700RENCANA PENGELOLAAN PERSEDIAAN OPTIMAL OBAT COVID 19 DI RUMAH SAKIT XYZPenelitian yang dilakukan di Rumah Sakit XYZ ini bertujuan untuk merencanakan pengendalian persediaan obat Covid 19 untuk memberikan pelayanan terbaik kepada para pasien agar tidak ada permasalahan dalam memenuhi permintaan pasien pengidap penyakit covid 19 Ada 5 jenis obat covid 19 yang akan dijadikana bahan penelitan yaitu Remdasivir Avigan tablet 200 mg Oseltamivir capsul 75 mg Vitamin D3 1000 IU dan Zinc kapsul 100 mg Untuk meramalkan permintaan yang akan datang digunakan data permintaan 5 jenis obat tersebut pada tahun 2020 Dengan menggunakan data hasil peramalan dengan metode EOQ dapat dibandingkan dengan total cost rumah sakit lakukan selama tahun 2020 dalam mengelola persediaan jenis obat covid 19 Dari perbandingan total cost tersebut rumah sakit dapat mengetahui jika rumah sakit menggunakan metode EOQ untuk mengoptimalkan persediaannya maka rumah sakit dapat menghemat sebesar Rp 6270075 untuk obat remdesivir Rp 3227818 untuk obat avigan tablet 200 mg Rp 240362 untuk obat oseltamivir Rp 2452788 untuk Vitamin D3 1000 IU dan Rp 363227 untuk Zinc kapsul Dengan total penghematan sebesar Rp 9591762 dan dengan selisih Rp12426764 dari total biaya persediaan rumah sakit yang sebesar Rp 22018526https://digilib.esaunggul.ac.id/rencana-pengelolaan-persediaan-optimal-obat-covid-19-di-rumah-sakit-xyz-22956.htmlMon, 10 Jan 2022 14:21:42 +0700PENGARUH KOMPLEKSITAS OPERASI PERUSAHAAN UKURAN PERUSAHAAN DAN UMUR PERUSAHAAN TERHADAP AUDIT DELAY PADA PERUSAHAAN MANUFAKTUR SUB SEKTOR TEKSTILE DAN GARMEN YANG TERDAFTAR DI BURSA EFEK INDONESIA BEI PERIODE 2016-2019The complexity of company operations is measured by the number of subsidiary companies company size is measured by Ln total assets and company age is measured by the year of research minus the year of listed IPO while audit delay is measured by the date of the audited report minus the date of closing the book The method used was purposive sampling the number of samples used in this study were 14 textile and garment companies listed on the Indonesia stock exchange for the periode 2016-2019 from a total population of 21 companies The type of data used is secondary data sourced from financial reports and the data analysis method used is Multiple Linier Regression The result of hypothesis testing show that simultaneously the complexity of the company s operation company size and company age on audit delay has a significant effect on audit delay But the company s operating complexity and company age have no effect on audit delayhttps://digilib.esaunggul.ac.id/pengaruh-kompleksitas-operasi-perusahaan-ukuran-perusahaan-dan-umur-perusahaan-terhadap-audit-delay-pada-perusahaan-manufaktur-sub-sektor-tekstile-dan-garmen-yang-terdaftar-di-bursa-efek-indonesia-bei-periode-20162019-22955.htmlFri, 07 Jan 2022 16:41:01 +0700RANCANG BANGUN APLIKASI PEMBELAJARAN KERANGKA MANUSIA BERBASIS AUGMENTED REALITYAugmented Reality adalah teknologi yang menggabungkan dunia maya dua dimensi ataupun tiga dimendi kedalam gambaran nyata Salah satu bidang yang menggunakan Augmented Reality adalah bidang pendidikan Pada bidang pendidikan Augmented Reality berfungsi sebagai media pembelajaran interaktif yang membuat pelajaran tersebut lebih menarik 3D objek dibuat dengan menggunakan aplikasi Blender 3D dan dikembangkan dengan menggunakan Software Unity Dengan mengambil gambar sebagai penanda kemudian gambar yang diambil dicocokan dengan gambar yang disimpan pada database Hasil dari penelitian ini adalah membantu siswa dalam mempelajari dan mengenali rangka manusia menggunakan teknologi Augmented Reality ARhttps://digilib.esaunggul.ac.id/rancang-bangun-aplikasi-pembelajaran-kerangka-manusia-berbasis-augmented-reality-22954.htmlFri, 07 Jan 2022 16:26:15 +0700PENGARUH EDUKASI GIZI DENGAN MEDIA NUTRITION WEDDING PLANNER TERHADAP PENGETAHUAN DAN SIKAP GIZI PADA CALON PENGANTIN DI GEREJA BETHEL INDONESIALatar Belakang Menikah adalah salah satu momen yang paling penting Salah satu faktor yang harus dipersiapkan adalah kesiapan fisik Namun faktor ini kadang terabaikan oleh calon pengantin Selain itu status gizi calon ibu menjadi salah satu pengaruh yang paling besar terhadap kondisi kehamilan Ibu hamil dengan keadaan sehat dan memiliki status gizi yang baik ditentukan jauh sebelumnya termasuk pada calon pengantinTujuan Maksud diadakannya riset ini ialah untuk mencari dampak Nutrition Wedding Planner bagi ilmu serta sikap gizi calon pengantin wanita di Gereja Bethel Indonesia Metode yang dipakai adalah Quasi Eksperimental one group pretest posttest Besaran sampel yang digunakan dalam riset ini adalah 34 orang calon pengantin wanita Analisis bivariat menggunakan uji t-test dependen dan uji WilcoxonHasil Penelitian Hasil penelitian menunjukkan adanya perbedaan pengetahuan yang signifikan p-value 0001 antara pre-test 739123 dan post-test 2 867105 Pada variable sikap terdapat perbedaan yang signifikan p-value 0012 antara pre-test 87518 dan post-test 1 96917 Selain itu terdapat perbedaan sikap yang signifikan p-value 0001 antara pre-test 87518 dan post-test 2 100012 Kesimpulan Sehingga dapat dikatakan bahwa media Nutrition Wedding Planner dapat meningkatkan pengetahuan dan sikap pada calon pengantin wanita Media ini dapat digunakan oleh calon pengantin dalam mempersiapkan kehidupan rumah tangga yang sehat dan berkualitashttps://digilib.esaunggul.ac.id/pengaruh-edukasi-gizi-dengan-media-nutrition-wedding-planner-terhadap-pengetahuan-dan-sikap-gizi-pada-calon-pengantin-di-gereja-bethel-indonesia-22953.htmlFri, 07 Jan 2022 16:12:43 +0700PENGARUH PEMBERIAN EDUKASI MELALUI MEDIA KANTONG ASI TERHADAP PENGETAHUAN DAN SIKAP IBU PEKERJA DI POSYANDU KEMUNING DI DESA PASIR BARAT KECAMATAN JAMBE KABUPATENTANGERANGLatar Belakang United Nation Childrens Fund UNICEF dan World HealthOrganization WHO merekomendasikan pemberian ASI Eksklusif untuk menurunkanangka mortalitas dan morbiditas bayi Ibu bekerja cenderung tidak memberikan ASIeksklusif dibandingkan ibu yang tidak bekerja atau Ibu Rumah Tangga IRTKurangnya dukungan tempat kerja menjadi salah satu faktor penyebab kegagalan ASIeksklusif pada ibu bekerja Penelitian ini menggunakan media edukasi yaitu mediaKantong ASI untuk menyimpan ASI Perah agar ibu tetap memberikan ASI Eksklusifwalaupun sedang bekerjaTujuan Penelitian ini bertujuan untuk mengetahui pengaruh pemberian edukasimelalui media kantong ASI terhadap pengetahuan dan sikap ibu pekerja di PosyanduKemuning di Desa Pasir Barat Kecamatan JambeMetode Penelitian ini mengambil sampel sebanyak 33 orang ibu balita yang ada diPosyandu Kemuning dan menggunakan metode penelitian pre expremental designdengan desain one group pre-test dan post-test Uji analisis bivariat yang digunakanadalah uji Paired Sample t-testHasil Hasil uji bivariat menunjukkan terdapat perbedaan yang signifikan pada skorrata-rata pengetahuan dan sikap ASI Eksklusif dan ASI Perah dengan metode ceramahdan media kantong ASI p8804005Kesimpulan Pemberian edukasi menggunakan metode ceramah dan kantong ASIsapat meningkatkan pengetahuan dan sikap ibu balita Media kantong ASI dapatdigunakan sebagai media edukasi jangka panjang karena dengan media tersebut ibubalita jadi mengetahui tetap bisa memberikan ASI walaupun ibu sedang bekerja danmenggunakan kantong ASI untuk menyimpan ASI Perahhttps://digilib.esaunggul.ac.id/pengaruh-pemberian-edukasi-melalui-media-kantong-asi-terhadap-pengetahuan-dan-sikap-ibu-pekerja-di-posyandu-kemuning-di-desa-pasir-barat-kecamatan-jambe-kabupatentangerang-22952.htmlFri, 07 Jan 2022 15:25:58 +0700HUBUNGAN KONDISI LINGKUNGAN RUMAH DAN PRILAKU TERHADAP KEJADIAN ISPA PADA BALITA UMUR 1-5 TAHUN DI DESA PEKAYON KABUPATEN TANGERANG TAHUN 2021Kejadian ISPA pada balita merupakan penyebab utama morbiditas dan mortalitas penyakit menular di dunia ISPA di negara berkembang memperkirakan insidens angka kematian balita di atas 40 per 1000 kelahiran hidup adalah 15-20 pertahun pada golongan usia balita Tingkat mortalitas sangat tinggi pada bayi anak-anak dan orang lanjut usia terutama di negara dengan pendapatan per kapita rendah dan menengah Angka kasus ISPA pada balita di Puskesmas Sukadiri Tahun 2018 prevalensi 4514 Tahun 2019 prevalensi 5218 Pada tahun 2020 d prevalensi 4291 Penelitian ini bertujuan untuk mengetahui Hubungan Kondisi Lingkungan Rumah Dan Perilaku Terhadap Kejadian ISPA Pada Balita Umur 1-5 Tahun Di Desa Pekayon Kabupaten Tangerang Tahun 2021 Jenis Penelitian ini adalah kuantitatif dengan desain Cross Sectional Data yang dikumpulkan yaitu data primer yang didapat dari wawancara observasi pengukuran dan pengisian kuesioner pada 154 responden dengan teknik Stratified Sampling Hasil penelitian dari uji statistik Chi Square menunjukkan terdapat hubungan antara pencahayaan p 0008 jenis dinding p 0000 jenis lantai p 0002 langit-langit rumah p 0011 perilaku merokok p 0010 dan tidak terdapat hubungan antara kepadatan hunian p 0455 dengan kejadian ISPA pada balita umur 1-5 di desa pekayon tahun 2021 Diharapkan Puskesmas Sukadiri bisa mencegah terjadinya ISPA dengan cara melakukan penyuluhan pencegahan penyakit ISPA pada balitahttps://digilib.esaunggul.ac.id/hubungan-kondisi-lingkungan-rumah-dan-prilaku-terhadap-kejadian-ispa-pada-balita-umur-15-tahun-di-desa-pekayon-kabupaten-tangerang-tahun-2021-22951.htmlFri, 07 Jan 2022 15:16:27 +0700PENERAPAN METODE OEE PADA PRODUKSI BODY SCOOTER 609 DENGAN PENYELESAIAN KAIZEN 5S DI PT SHP TOYSPT SHP Toys merupakan perusahaan yang bergerak pada industri mainan yang dapat ditunggangi anak anak semua produk yang ada merupakan berbahan plastik yang di cetak menggunakan mesin inject pada kali ini penulis berfokus kepada salah satu part produk nya yang bernama Body scooter 609 adpun permasalahan yang dihadapi perusahhan ini dalam proses produksi nya seperti keefektifitas mesin hingga produk yang dihasilkan Untuk itu dilakukan perhitungan nilai Overall Equipment Effectivness dan mencari apa apa saja yang menjadi penyebab terjadinya kekurangan yang mempengaruhi nilai ketiga variabel utama dalam menentukan nilai OEE dengan diagram sebab akibat atau yang akrab nama lainnya Fishbone Diagramdan Kaizen 5shttps://digilib.esaunggul.ac.id/penerapan-metode-oee-pada-produksi-body-scooter-609-dengan-penyelesaian-kaizen-5s-di-pt-shp-toys-22950.htmlFri, 07 Jan 2022 14:40:57 +0700PENGARUH GREEN MARKETING TERHADAP KEPUTUSAN PEMBELIAN KONSUMEN MELALUI MINAT BELI KONSUMEN DI STARBUCKS JAKARTA UTARAPenelitian ini menguji pengaruh green product dan green advertising terhadap minat beli dengan variable Keputusan Pembelian sebagai variabel intervening Metode analisis yang digunakan dalam penelitian ini adalah analisis jalur Teknik Pengambilan sampel dalam penelitian ini menggunakan non probability sampling dengan teknik purposive sampling Jumlah sampel yang digunakan sebanyak 155 responden yang merupakan konsumen Starbucks Jakarta Utara Hasil dari penelitian ini menunjukkan bahwa terdapat pengaruh signifikan antara green product dan green advertising terhadap keputusan pembelian green advertising terhadap minat beli serta pengaruh signifikan antara keputusn pembelian terhadap minat beli dan hasil yang tidak signifikan antara green product terhadap minat beli Serta hasil dalam penelitian ini menunjukkan ternyata variabel keputusan pembelian dapat memediasi hubungan antara green product dan green advertising terhadap minat belhttps://digilib.esaunggul.ac.id/pengaruh-green-marketing-terhadap-keputusan-pembelian-konsumen-melalui-minat-beli-konsumen-di-starbucks-jakarta-utara-22949.htmlFri, 07 Jan 2022 14:27:33 +0700PERANCANGAN APLIKASI PEMBELAJARAN SISTEM PERNAFASAN MANUSIA DENGAN KONSEP GAMIFICATION STUDI KASUS SDN SRENGSENG 04 PAGIPernafasanrespirasi merupakan pertukaran O2oksigen dan CO2karbondioksida antara sel-sel tubuh serta lingkungan Pernafasan juga merupakanperistiwa penghirupan udara dari luar yang mengandung O2 dan mengeluarkanCO2 sebagai sisa dari oksidasi dalam tubuhSistem pernafasan merupakan salah satu materi pelajaran pada sekolah dasaryakni kelas 5 sd Materi pelajaran yang diberikan merupakan pengenalan dasarsistem pernafasan manusia Dalam penyampaian materi pengenalan sistempernafasan ini diperlukan penyesuaian agar anak-anak mampu tertarik denganmateri pelajarna ini Untuk menghindari kejenuhan belajar pada anak makapenyampaian materi sistem pernafasan dapat dikombinasikan dengan metodegamification Aplikasi sistem pernafasan dengan konsep gamifikasi ini berbasismobile sehingga lebih fleksibel terhadap penggunanya nantiPada penelitian ini dihasilkan aplikasi pembelajaran Sistem PernafasanManusia yang dapat memudahkan penyampaian materi agar lebih efisien dalampenggunaan waktu belajar mengajar sehingga akan banyak waktu tersisa untuksiswa-siswi memahami atau berdiskusi ulang mengenai materi yang adaBerdasarkan data pengujian dari hasil wawancara dengan pengajar maka dapatdisimpulkan bahwa aplikasi pembelajaran Sistem Pernafasan Manusia ini dapatditerapkan di SDN 04 Pagi Srengseng sebagai media pembelajaran materiSistem Pernafasan pada kelas 5https://digilib.esaunggul.ac.id/perancangan-aplikasi-pembelajaran-sistem-pernafasan-manusia-dengan-konsep-gamification-studi-kasus--sdn-srengseng-04-pagi-22948.htmlFri, 07 Jan 2022 14:19:23 +0700PERBEDAAN ANTARA LATIHAN BICYCLE CRUNCH DAN SIT UP PADA LATIHAN CORE STABILITY UNTUK MENURUNKAN LINGKAR PERUT WANITA USIA 25-35 TAHUNTujuan Untuk mengetahui perbedaan latihan bicycle crunch dan latihan sit up pada latihan core stability untuk menurunkan lingkar perut wanita usia 25-35 tahun Metode Penelitian bersifat quasi eksperiment dengan total sampel sebanyak 20 orang yang dipilih berdasarkan teknik purposive random sampling Sampel dibagi menjadi 2 kelompok yang masing-masing 10 orang dengan frekuensi latihan yang diberikan 3 kali seminggu selama 5 minggu dimana kelompok I diberikan latihan bicycle crunch dan latihan core stability sedangkan kelompok II diberikan latihan sit up dan latihan core stability Pada tiap kelompok nilai lingkar perut wanita diukur dengan menggunakan meterline cm Hasil Uji hipotesis I dan II dengan paired sampel t-test menunjukan nilai p0001 yang artinya kombinasi latihan bicycle crunch atau latihan sit up pada latihan core stability dapat menurunkan lingkar perut wanita Hasil uji hipotesis III dengan Mann Whitney U Test didapatkan nilai p0001 yang artinya terdapat perbedaan yang bermakna antara kedua intervensi tersebut dalam menurunkan lingkar perut dengan nilai mean rank 1450 pada kelompok I dan 650 pada kelompok II Kesimpulan Ada perbedaan antara latihan bicycle crunch dengan latihan core stability dan latihan sit up dengan latihan core stability terhadap penurunan lingkar perut wanita usia 25-35 tahunhttps://digilib.esaunggul.ac.id/perbedaan-antara-latihan-bicycle-crunch-dan-sit-up-pada-latihan-core-stability-untuk-menurunkan-lingkar-perut-wanita-usia-2535-tahun-22947.htmlFri, 07 Jan 2022 11:27:04 +0700PENGARUH KUALITAS PELAYANAN DAN KEPUASAN TERHADAP LOYALITAS PELANGGAN STUDI PADA RESTORAN MITARIK LAIKER DI JAKARTAMenjamurnya industri kuliner membuat para pesaing usaha untuk berlomba-lomba dalam memberikan pelayanan maupun produk yang dijual Ketika pelanggan tersebut pergi ke sebuah restoran tentu selalu memiliki pertimbangan tersendiri sebelum memutuskan untuk singgah makan dan minum di restoran tertentu Tentunya aspek yang menjadi proritas utama adalah kualitas pelayanan Kualitas pelayanan yang tinggi tentu akan membuat konsumen puas sehingga konsumenpun tidak ragu untuk datang kembali Penelitian ini bertujuan untuk mengetahui pengaruh kualitas pelayanan dan kepuasan terhadap loyalitas pelanggan pada restoran Mitarik Laiker di Jakarta Populasi dalam penelitian ini adalah seluruh pelanggan restoran Mitarik Laiker di Jakarta yang jumlahnya tidak diketahui Sampel dalam penelitian ini 150 responden dengan menggunakan teknik purposive sampling Penelitian ini menggunakan metode Structural Equation Modelling SEM Hasil penelitian ini menunjukan bahwa kualitas pelayanan berpengaruh terhadap kepuasan kepuasan berpengaruh terhadap loyalitas pelanggan dan kualitas pelayanan berpengaruh terhadap loyalitas pelangganhttps://digilib.esaunggul.ac.id/pengaruh-kualitas-pelayanan-dan-kepuasan-terhadap-loyalitas-pelanggan-studi-pada-restoran-mitarik-laiker-di-jakarta-22946.htmlFri, 07 Jan 2022 11:15:44 +0700LAPORAN HASIL KULIAH KERJA LAPANGANKEGIATAN MARKETING DI PT DEXA MEDICA TANGERANGSemakin majunya ilmu pengetahuan dan teknologi dalam era ini mendorongkemajuan dalam berbagai bisnis Adanya kemajuan ilmu dan teknologimemudahkan para pelaku bisnis dalam berbagai kegiatan seperti produksidistribusi pemasaran komunikasi bisnis dan berbagai aspek lain yang akanmenunjang kegiatan bisnis Persaingan yang berat mengharuskan para lulusanperguruan tinggi yang ingin terjun di dunia kerja harus memiliki bekalpengalaman yang cukup Melalui program kuliah kerja lapangan ini mahasiswamendapatkan kesempatan untuk menerapkannya dilapangan tentang apa sajayang selama ini di pelajari secara teori maupun praktikhttps://digilib.esaunggul.ac.id/laporan-hasil-kuliah-kerja-lapangankegiatan-marketing-di-pt-dexa-medica-tangerang-22945.htmlFri, 07 Jan 2022 10:22:47 +0700PERANCANGAN MEDIA DOKUMENTASI VIDEO INLINE SKATE NO FEARInline skate merupakan salah satu olahraga yang sedang marak di Indonesia khususnya di kalangan anak-anak Hal ini dilihat dari mengikatnya pertumbuhan komunitas inline skate yang telah tersebar lebih dari 30 komunitas di seluruh Indonesia Saat pergi bermain anak-anak membawa berbagai macam peralatan inline skate beserta keperluan pribadi mereka lainnya sehingga diperlukan suatu sarana bawa berupa tas yang dapat memenuhi kebutuhan merekaMetode penelitian yang digunakan adalah campuran yang mencakup kajian pustaka wawancara observasi dan studi perilaku Wawancara dilakukan dengan komunitas inline skateObservasi dilakukan untuk mengetahui kegiatan yang dilakukan anak-anak saat pergi bermain inline skate Penelitian ini bertujuan untuk menghasilkan sebuah video dokumentasi pada aktivitas inline skate untuk masyarakat yang baru mau memulai bermain inline skatehttps://digilib.esaunggul.ac.id/perancangan-media-dokumentasi-video-inline-skate--no-fear-22944.htmlFri, 07 Jan 2022 10:13:13 +0700PERANCANGAN KURSI ANAK MULTIFUNGSI UNTUK USIA TKPada umumnya para pendidik tidak terlalu memperhatikan aspek desain furnitur untuk pada anak didiknya Kursi anak merupakan salah satu furnitur peran penting dala proses belajar usia anak TK Jenis kursi ini mengutamakan desain yang menarik dan kenyamnan sehingga anak berkonsentrasi dalam proses belajar Kursi anak TK pada umumnya cenderung kurang memperhatikan bentuk dan fungsinya dan belum dimanfaatkan secara optimal serta desain bentuknya yang monoton sehingga kurang menarik untuk anak Perancangan kursi anak multifungsi bertujuan untuk membuat anak TK menjadi menarik agar memotivasi anak semangat dan fokus belajar dengan adanya memiliki fungsi lain tanpa mengganggu aktivitas belajar anakhttps://digilib.esaunggul.ac.id/perancangan-kursi-anak-multifungsi-untuk-usia-tk-22943.htmlFri, 07 Jan 2022 10:04:28 +0700ANALISIS PERBEDAAN SEBELUM DAN SESUDAH PEMBERIAN WORKPLACE STRETCHING EXERCISE TERHADAP PENURUNAN KELUHAN MUSCULOSKELETAL DISORDERS MSDs PADA PEKERJA BAGIAN PRODUKSI DI PT CROWN PRATAMA TAHUN 2021Musculoskeletal Disorders MSDs merupakan suatu masalah yang dapat dialami oleh pekerja yang melakukan pekerjaan seperti membungkuk memanjat merangkak menggapai memutar aktivitas berlebihan atau gerakan berulang MSDs dapat dicegah dengan melakukan Workplace Stretching Exercise WSE yang bermanfaat untuk mengurangi risiko cedera musculoskeletal mengurangi kelelahan meningkatkan keseimbangan dan postur otot serta meningkatkan koordinasi otot Penelitian ini menggunakan jenis penelitian kuantitatif serta menggunakan desain penelitian quasi experiment dengan the one-group pretest-posttest design dan pengambilan sampel secara total sampling Responden penelitian ini adalah 34 pekerja bagian produksi PT Crown Pratama tahun 2021 Uji statistik yang digunakan peneltian ini adalah uji T-paired Hasil uji univaria mean keluhan MSDs sebelum dan sesudah pemberian WSE yaitu 4297 dan 3629 Hasil uji bivariat ditemukan ada perbedaan keluhan Musculoskeletal Disorders MSDs sebelum dan sesudah workplace stretching exercise Sehingga disarankan agar PT Crown Pratama membuat program workplace stretching exercise untuk mencegah dan mengendalikan keluhan Musculoskeletal Disorders MSDshttps://digilib.esaunggul.ac.id/analisis-perbedaan-sebelum-dan-sesudah-pemberian-workplace-stretching-exercise-terhadap-penurunan-keluhan-musculoskeletal-disorders-msds-pada-pekerja-bagian-produksi-di-pt-crown-pratama-tahun-2021-22942.htmlFri, 07 Jan 2022 09:43:22 +0700GAMBARAN KESESUAIAN SISTEM PROTEKSI KEBAKARAN AKTIF BERDASARKAN STANDAR NATIONAL FIRE PROTECTION ASSOCIATION NFPA DI ITC KUNINGAN TAHUN 2021Pusat perbelanjaan merupakan salah satu tempat yang memiliki risiko kebakaran Sistem proteksi kebakaran aktif adalah sarana proteksi kebakaran yang harus digerakkan dengan sesuatu untuk berfungsi memadamkan kebakaran Berdasarkan data yang diperoleh di ITC Kuningan pada tahun 2019 pernah terjadi percikan api disalah satu kios Dampak dari kebakaran tersebut dirasakan oleh penyewa kios yaitu kerugian finansial dan menurunnya produktivitas Penelitian ini bertujuan untuk mengetahui gambaran kesesuaian sistem proteksi aktif berdasarkan National Fire Protection Association NFPA 10 14 13 dan 72 di ITC Kuningan tahun 2021 Jenis penelitian ini adalah penelitian kuantitaif dengan pendekatan cross sectional desain studi yang digunakan adalah observasional dengan menggunakan lembar checklist Analisis yang dilakukan adalah analisis perbandingan dengan standar NFPA Hasil penelitian menunjukkan bahwa terdapat 5 dari 14 elemen pada APAR yang tidak sesuai standar NFPA 10 sehingga mendapatkan skoring 8162 dengan kategori Baik Terdapat 5 dari 15 elemen hidrant yang tidak sesuai standar NFPA 14 sehingga mendapatkan skoring 8389 dengan kategori Baik Terdapat 2 dari 12 elemen sprinkler yang tidak sesuai standar NFPA 13 sehingga mendapatkan skoring 8333 dengan kategori Baik Terdapat 1 dari 6 elemen detektor kebakaran yang tidak sesuai standar NFPA 72 sehingga mendapatkan skoring 8333 dengan kategori Baik Terdapat 1 dari 8 elemen alarm kebakaran yang tidak sesuai standar NFPA 72 sehingga mendapatkan skoring 8750 dengan kategori baikhttps://digilib.esaunggul.ac.id/gambaran-kesesuaian-sistem-proteksi-kebakaran-aktif-berdasarkan-standar-national-fire-protection-association-nfpa-di-itc-kuningan-tahun-2021-22941.htmlFri, 07 Jan 2022 09:21:40 +0700FAKTOR-FAKTOR YANG BERHUBUNGAN DENGAN PERILAKU TIDAK AMAN UNSAFE ACT PADA PEKERJA SECTION 1 DAN SECTION 2 DI PROYEK PEMBANGUNAN JALAN TOL CENGKARENG BATU CEPER KUNCIRAN PT WIJAYA KARYA PERSERO TBK TAHUN 2021Perilaku tidak aman Unsafe Act merupakan seluruh tinfakan yang dilakukan olehmanusia dan dapat membahayakan diri sendiri orang lain peralatan danlingkungan kerja sekitarnya hal ini dilatar belakangi oleh faktor-faktor internalseperti sikap dan tingkahlaku yang tidak aman kurang pengetahuan danketerampilan cacat tubuh yang tdiak terlihat keletihan dan kelesuan Penelitianini bertujuan untuk mengetahui faktor-faktor yang berhubungan dengan perilakutidak aman Unsafe Act pada pekerja Section 1 dan Section 2 di ProyekPmbangunan Jalan Tol Cengkareng Batu Ceper Kunciran PT Wijaya KaryaPersero Tbk Tahun 2021 Jenis penelitian ini adalah kuantitatif dengan desainpenelitian cross sectional Populasi dari penelitian ini adalah seluruh pekerjaSection 1 dan Section 2 di Proyek Pmbangunan Jalan Tol Cengkareng BatuCeper Kunciran PT Wijaya Karya Persero Tbk yang berjumlah 103 pekerjaSampel dalam penelitian ini berjumlah 53 sampel pekerja dengan teknikpengambilan sampel yaitu Sampling acak sederhana Simple Random SamplingMetode pengumpulan data sumber informasi yang digunakan pada penelitian iniyaitu berupa data primer dan data sekunder dengan menggunakan alat ukur berupakuesioner Hasil penelitian dari uji statistik Chi Square menunjukkan terdapathubungan antara pengetahuan p0000 sikap p0000 peran pengawasp000 pelatihan K3 p0000 dengan perilaku tidak aman unsafe act padapekerja Section 1 dan Section 2 di Proyek Pmbangunan Jalan Tol Cengkareng Batu Ceper Kunciran PT Wijaya Karya Persero Tbk Tahun 2021https://digilib.esaunggul.ac.id/faktorfaktor-yang-berhubungan-dengan-perilaku-tidak-aman-unsafe-act-pada-pekerja-section-1-dan-section-2-di-proyek-pembangunan-jalan-tol-cengkareng--batu-ceper--kunciran-pt-wijaya-karya-persero-tbk-tahun-2021-22940.htmlFri, 07 Jan 2022 09:10:04 +0700HUBUNGAN ANTARA SELF-EFFICACY DENGAN STRESPADA MAHASISWA TINGKAT AKHIR DALAM PENYUSUNAN SKRIPSI SAAT PANDEMI COVID-19 TAHUN 2021Stres merupakan suatu kondisi ketegangan yang ditimbulkan karena adanya interaksi seseorang dengan lingkungan yang dapat mempengaruhi emosi proses berpikir dan kondisi fisik seseorang Penelitian ini dilakukan untuk mengetahui Hubungan Antara Self-Efficacy dengan Stres Pada Mahasiswa Tingkat Akhir Dalam Penyususnan Skripsi Saat Pandemi Covid-19 Tahun 2021 Jenis penelitian ini menggunakan metode kuantitatif dengan desain studi cross sectional Populasi pada penelitian ini adalah mahasiswa tingkat akhir Prodi Kesehatan Masyarakat Universitas Esa Unggul yang sedang dalam proses penyusunan skripsi dan sampel dalam penelitian ini berjumlah 136 mahasiswa Teknik pengambilan sampel pada penelitian ini yaitu menggunakan stratified random sampling dengan analisis data univariat dan bivariat menggunakan uji Chi Square Hasil penelitian menunjukkan proporsi tertinggi mahasiswa yang mengalami stres sebanyak 69 orang 507 dan mahasiswa yang memiliki self efficacy tinggi sebanyak 70 orang 515 Hasil penelitian dari uji statistik Chi Square menunjukan terdapat hubungan antara self-efficacy p 0001 PR 1989 CI 95 1382-2861 dengan stres pada mahasiswa tingkat akhir dalam penyusunan skripsi saat pandemi covid 19 tahun 2021 Mahasiswa diharapkan dapat meningkatkan self-efficacy yang dimiliki dengan memandang skripsi sebagai tantangan memotivasi diri sendiri dengan menanamkan keyakinan atas kemampuan yang dimiliki untuk menyelesaikan skripsi meningkatkan usaha mengembangkan tujuan dan berkomitmen untuk mencapai tujuan tersebut serta membuat kelompok belajar yang dapat meningkatkan self-efficacyhttps://digilib.esaunggul.ac.id/hubungan-antara-selfefficacy-dengan-strespada-mahasiswa-tingkat-akhir-dalam-penyusunan-skripsi-saat-pandemi-covid19-tahun-2021-22939.htmlFri, 07 Jan 2022 09:03:04 +0700